Deck 15: Gene Regulation in Eukaryotes

Question 1

What activates CREB?

A) Binding of cAMP
B) Phosphorylation
C) Dimerization
D) None of the answers are correct

Answer 1

B

Question 2

S1 nuclease will cleave which of the following?

A) Double-stranded DNA
B) Single-stranded DNA
C) A single-stranded probe hybridized to a particular gene
D) Chromosomal DNA in an open conformation

Answer 2

B

Question 3

Which of the following would also work as an enhancer for the following bi-directional enhancer? 5' GTTC 3' 3' CAAG 5'

A) 5' GAAC 3' 3' CTTG 5'
B) 5' CTTG 3' 3' GAAC 5'
C) 5' CAAG 3' 3' GTTC 5'
D) More than one of the answers are correct

Answer 3

A

Question 4

What would be the result of a mutation in Hsp90?

A) Glucocorticoid receptor could not form a dimmer
B) The nuclear localization signal would no longer function
C) Expression of the regulated genes would become constitutive
D) The hormone would not be able to bind to the glucocorticoid receptor

Question 5

What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B?

A) Alternative splicing
B) RNA editing
C) RNA interference
D) Covalent modification of RNA

Question 6

What basal transcription factor is most often affected by regulatory transcription factors?

A) TFIIB
B) TFIID
C) TFIIE
D) TFIIF

Question 7

Which of the following mRNAs would be found at the lowest concentration?

A) 5' GGAUGGCCGUUUGAAAAAAAAAAAAAAAAAAAAA 3'
B) 5' GGAUGGCGACCUGAAUUUAAUUUAAUUUAAAAAA 3'
C) 5' GGAUGGAAGUUUGAAUUUAAUUUAAAAAAAAAAA 3'
D) 5' GGAUGGGGACUUGAAUUAAAAAAAAAAAAAAAAA 3'

Question 8

A person with a mutation in IRP that prevents it from binding iron. What effect will this have?

A) Ferritin will not be made, so iron intake must be maximized
B) There will be excess ferritin, so iron intake must be lowered
C) Transferrin will not be made, so iron intake must be maximized
D) There will be excess transferrin, so iron intake must be lowered

Question 9

In which of the following scenarios would gene expression be the lowest?

A) The CpG island upstream of the gene is unmethylated
B) Injecting antisense RNA corresponding to the mRNA of the gene
C) Deletion of a sequence upstream of the gene known to be a silencer
D) Injecting double-stranded RNA corresponding to the mRNA of the gene

Question 10

Which is not an example of RNA processing regulation?

A) RNA concentration
B) RNA editing
C) Alternative splicing
D) eIF2a protein kinases

Question 11

Which of the following relationships is true?

A) The more stable an mRNA is, the higher its concentration
B) The more unstable an mRNA is, the lower its concentration
C) The more unstable an mRNA is, the higher its concentration
D) More than one of the answers are correct

Question 12

Where is the IRE located in the ferritin gene?

A) 5' end of DNA
B) 5' end of mRNA
C) 3' end of DNA
D) 3' end of mRNA

Question 13

What is an example of RNA editing?

A) Changing a valine codon to a stop codon
B) Methylation of cytosine bases
C) Formation of RISC
D) Alternative splicing

Question 14

Based on the following mature mRNAs, what exons are constitutive? I. 1-2-3-4-7-8-10 II. 2-4-5-6-7-9 III. 1-4-6-7-8 IV. 1-2-4-7-10

A) 1 and 2
B) 1 and 4
C) 2 and 7
D) 4 and 7

Question 15

What structural motifs promote dimerization?

A) Zinc finger
B) Leucine zipper
C) Helix-turn-helix
D) Helix-loop-helix

Question 16

SR proteins are splicing factors rich in .

A) Arginine
B) Cysteine
C) Asparagine
D) Proline

Question 17

Which of the following is a steroid receptor?

A) GRE
B) IRE
C) CRE
D) None of the answers are correct

Question 18

Which mechanisms are used by miRNAs to regulate gene expression?

A) Targeted degradation of mRNAs
B) Targeted inhibition of mRNA translation
C) Both A and B
D) Neither A nor B

Question 19

A mutation in which of the following would result in little or no expression of a gene regulated by a CRE?

A) G protein
B) Adenylyl cyclase
C) Protein kinase A
D) All of the answers are correct

Question 20

eIF2a is phosphorylated in order to inhibit transcription. What is occurring at the molecular level?

A) Phosphorylated eIF2a binds to tRNAs, preventing them from attaching its amino acid
B) Phosphorylated eIF2a binds to eIF2B, inhibiting its activity
C) Phosphorylated eIF2a binds to the mRNA, blocking the Shine-Delgarno sequence and preventing translational initiation
D) All of the answers are correct

Question 21

Genomic imprinting is a result of .

A) Nucleosome location
B) Histone activation
C) DNA methylation
D) Serine to leucine changes in the genetic code

Question 22

Which one of the following directly interacts with the DNA as a transcriptional regulator?

A) cAMP
B) G protein
C) Protein kinase A
D) CREB protein dimmer
E) None of the answers are correct

Question 23

Transcription factors are proteins that influence the ability of the RNA polymerase to transcribe a
gene.

Question 24

A repressor protein would enhance the ability of TFIID to bind to the TATA box of the promoter.

Question 25

The stability of mRNA is due mostly to which of the following?

A) GC content of the message
B) Poly-A binding protein
C) Methylation
D) 5' capping
E) Alternative splicing

Question 26

Explain why yeast genes with a single intron have essentially no alternative splicing.

A) Yeast genes never have alternative splicing.
B) Removal of a single intron leads to splicing of the poly-A tail which prevents further splicing.
C) Methylation of the single intron prevents further splicing.
D) Removal of a single intron only leads to one possible outcome for spliced mRNA.
E) None of the above.

Question 27

cAMP is known as a second messenger system since the pathway is first activated by a extracellular
signaling molecule

Question 28

Guide RNA is used in which of the following processes?

A) DNA methylation
B) Alternative splicing
C) Chromatin condensation
D) RNA editing
E) None of the answers are correct

Question 29

Regulatory transcription factors may influence gene expression in which of the following ways?

A) Recruiting proteins to the promoter that enhance chromatin compaction
B) By effecting the ability of TFIID to bind to the core promoter
C) Influencing the ability of the RNA polymerase to form an initiation complex
D) All of the answers are correct

Question 30

Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences.

Question 31

Which of the following is incorrect regarding the glucocorticoid hormomes?

A) They interact with receptors located in the plasma membrane of the cell
B) After interacting with the receptor, they release HSP90
C) The receptors form a homodimer that travels to the nucleus
D) The homodimer interacts with GRE, activating transcription

Question 32

RNAi is used in eukaryotic cells only to defend against viruses and transposable elements.

Question 33

If a portion of a transcription factor's domain is the same in a variety of organisms, it is called a motif.

Question 34

Regulatory transcription factors may be regulated by .

A) Covalent modifications
B) Protein-protein interactions
C) Use of effector molecules
D) All of the answers are correct

Question 35

Which of the following is an example of a motif found in transcription factors?

A) Zinc finger
B) Leucine zipper
C) Helix-turn-helix
D) Helix-loop-helix
E) All of the answers are correct

Question 36

CpG islands are associated with which of the following?

A) Nucleosome location
B) DNA methylation
C) Steroid hormone activity
D) cAMP pathway

Question 37

A heterodimer occurs when two identical transcription factors interact on a sequence of DNA.
FALSE

Question 38

The exons of a gene are always expressed in a functional protein.

Question 39

Histone acetyltransferases would be directly involved in which of the following?

A) Formation of open chromatin
B) Movement of the nucleosome
C) Acetylation of lysines
D) Termination of gene expression

Question 40

Transcription factors recognize which of the following?

A) Response elements
B) Control elements
C) Regulatory elements
D) All of the answers are correct

Question 41

DNA methylation activates gene expression.

Question 42

DNA that contains actively transcribed genes would most likely contain chromatin in the closed
configuration.

Question 43

Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling.

Question 44

Receptors for steroid hormones are usually found in the nucleus of the cell.

Question 45

Steroid hormomes are an example of an effector which regulates regulatory transcription factor
activity.

Question 46

Housekeeping genes are unmethylated and active in most cells.