Deck 13: Translation of Mrna

Question 1

Which of the following would be considered an activated amino acid?

A) Amino acid · ATP · aminoacyl-tRNA synthetase
B) Amino acid · aminoacyl-tRNA synthetase
C) Amino acid + AMP + PPi
D) Amino acid · AMP

Answer 1

D

Question 2

a-helices and b-sheets are examples of what level of protein structure?

A) Primary structure
B) Secondary structure
C) Tertiary structure
D) Quanternary structure

Answer 2

B

Question 3

An anticodon is located on which of the following?

A) DNA
B) mRNA
C) rRNA
D) tRNA
E) snRNA

Answer 3

D

Question 4

Raney nickel converts cysteine to what?

A) Glycine
B) Asparagine
C) Alanine
D) Serine

Question 5

Which of the following is true according to the adaptor hypothesis?

A) The anticodon and amino acid have no relationship
B) A given tRNA can carry any of the twenty amino acids
C) tRNA binds to mRNA at the ribosome
D) An amino acid recognizes the codon in mRNA

Question 6

What is responsible for binding the initiator tRNA?

A) eIF2
B) EF-Tu
C) eIF3
D) EF-G

Question 7

What is the least number of tRNAs needed to carry isoleucine and what is the anticodon(s)?

A) One-5'IAU3'
B) One-5'UAU3'
C) Two-5'GAU3' and 5'UAU3'
D) Two-5'AUA3' and 5'UAI3'

Question 8

The genetic code is universal in nuclear DNA from bacteria to mammals.

Question 9

Which of the following is not a stop codon?

A) UGA
B) UUA
C) UAG
D) UAA

Question 10

What site on the ribosome is primarily responsible for holding the growing polypeptide?

A) A
B) E
C) P

Question 11

What is the modern theory of genetics?

A) One gene-one enzyme
B) One gene-one polypeptide
C) One gene-various number of enzymes
D) No relationship can be determined between genes and proteins

Question 12

eIF5 recruits what during the initiation stage?

A) 40S subunit
B) 50S subunit
C) 60S subunit
D) 70S subunit

Question 13

The primary structure of a protein is directly associated with .

A) Regular repeating shapes, such as beta-sheets
B) The three-dimensional shape of the protein
C) The linear sequence of the amino acids
D) The interaction of two or more peptide chains

Question 14

Which of the following codons is not degenerate to CUU?

A) CUC
B) UUG
C) CUA
D) AUU
E) UUA

Question 15

All mature polypeptides contain a methionine at the N-terminus.

Question 16

Adenine can base pair with cytosine and guanine as well as uracil.

Question 17

Which of the following is not true regarding the experiments of Beadle and Tatum?

A) They used the mold Neurospora as a model organism
B) They isolated strains that could not grow on minimal media
C) They established the link between a gene and an enzyme or protein
D) They were able to create loss-of-function mutations in any enzyme they chose

Question 18

Kozack's rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at -35 and -10. Where is the consensus sequence for translational initiation according to Kozack's rules?

A) -6 to +4
B) -12 to -2
C) +1 to +10
D) -9 to +1

Question 19

A tRNA that has an amino acids attached is called .

A) rRNA
B) Degenerate tRNA
C) Coding tRNA
D) Charged tRNA
E) None of the answers are correct

Question 20

How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

A) 7
B) 8
C) 10
D) 13

Question 21

A polyribosome would be found in which of the following types of cells?

A) Prokaryotic
B) Eukaryotic
C) Both

Question 22

The wobble base is usually associated with the second base of a codon.

Question 23

The Shine-Dalgarno sequence is found in eukaryotic cells.

Question 24

The peptidyltransferase complex is a component of which of the following?

A) DNA
B) tRNA
C) The ribosome
D) The functional protein
E) mRNA

Question 25

Proteins that are composed of two or more subunits or polypeptides are said the have quanternary
structure.

Question 26

RF1 and RF2 are active during .

A) Initiation
B) Elongation
C) Termination
D) Cotranslational import

Question 27

Cotranslational import occurs where?

A) In the Golgi
B) In the nucleus
C) In the endoplasmic reticulum
D) Throughout the cell

Question 28

The one-gene, one-enzyme hypothesis was first proposed by Beadle and Tatum.

Question 29

Where are the ribosomal subunits assembled?

A) Nucleus
B) Nucleoid
C) Nucleolus
D) Nuclear envelope

Question 30

The C-terminal of a polypeptide always contains which of the following?

A) A stop codon
B) A carboxyl group
C) An amino group
D) Carbon dioxide
E) None of the answers are correct

Question 31

With regard to Chapeville's experiment, what could not be the radioactive element used to label cysteine?

A) 15N
B) 35S
C) 14C
D) 3H

Question 32

The anticodon on the mRNA recognizes the codon on the tRNA.
FALSE

Question 33

The decoding function is conducted by which of the following?

A) The 16S rRNA
B) tRNA
C) mRNA
D) snRNA
E) Aminoacyl-tRNA synthetase

Question 34

The first person to suggest that a connection exists between the function of a gene and the production
of an enzyme was Archibald Garrod.

Question 35

The structure of the ribosome is uniform throughout a eukaryotic cell.

Question 36

A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?

A) Glycine
B) Proline
C) Alanine
D) Arginine

Question 37

Frequently, the start codon for the functional protein is not at the 5' end of the mRNA. In fact, there are often several codons 5' of the start codon in an edited mRNA prior to translation. What is the purpose of these codons in a eukaryotic system?

A) Ribosomal binding sites
B) Act as a promoter
C) Serve as sorting or traffic signals for the ribosome
D) Sites of spliceosome activity

Question 38

In eukaryotic systems, which of the following typically stops the process of translation?

A) Rho proteins
B) Aminoacyl tRNA synthase
C) rRNA
D) Stop codons
E) Introns

Question 39

The enzyme that attaches free amino acids to the tRNA molecule is called tRNA attachase.

Question 40

Where does mRNA/tRNA codon-anticodon recognition take place?

A) 30S
B) 40S
C) 50S
D) The surface between the two ribosomal subunits

Question 41

Transcription and translation may occur simultaneously in prokaryotic cells.

Question 42

During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the
amino acid in the A site.