Deck 17: Origins and Evolution

Question 1

Evidence for microbial life on Earth dates back to ________ ago.

A) 14 gigayears
B) 5 gigayears
C) 3.48 gigayears
D) 1.5 gigayears
E) 500 megayears

Answer 1

C

Question 2

A molecular clock is best defined as

A) the information contained in DNA or protein sequences that shows changes over time.
B) genes that under selective pressure show a higher rate in mutation frequencies.
C) organisms in favorable environments that have greater offspring potential.
D) the time between Earth's formation and the beginnings of life in an RNA world.
E) a monophyletic group of organisms that replicate in synchrony.

Answer 2

A

Question 3

Which of the following reactions suggests the plausibility for RNA chromosome replication in the RNA World model?

A) Compared to DNA, synthesis and degradation of RNA require less energy.
B) Uracil, a pyrimidine in RNA, is the precursor of thymine, used in the synthesis of DNA.
C) Some ribozymes splice introns in mRNA.
D) Some ribozymes catalyze synthesis of complementary strands of RNA.
E) Peptide bond formation is catalyzed by ribosomal RNA.

Answer 3

D

Question 4

Evidence of life left in the geological record is known as

A) biosignatures.
B) genetic markers.
C) abiotic artifacts.
D) enzyme markers.
E) molecular weight markers.

Question 5

Which label on the figure below is NOT correct?

A) A-oldest stromatolites
B) B-chloroplasts and mitochondria
C) C-colonial organism
D) D-filamentous cyanobacteria
E) E-early eukaryotes

Question 6

The loss of genes encoding for unselected traits is known as

A) random mutation.
B) natural selection.
C) reductive evolution.
D) clade evolution.
E) random recombination.

Question 7

Oparin at Moscow University, Miller and Urey at the University of Chicago, and Juan Oró at the University of Houston performed experiments throughout the twentieth century to prove that

A) organic macromolecules can arise from abiotic conditions.
B) micelle formation generated the first membranes.
C) RNA was the catalytic molecule of early Earth.
D) TCA cycle generates amino acids.
E) iron band formations were caused by photoferrotrophy.

Question 8

The sum total of all life on Earth is called the

A) lithosphere.
B) mantle.
C) core.
D) atmosphere.
E) biosphere.

Question 9

Analyses of d¹³C % has revealed biosignatures in

A) igneous rock.
B) mantle rock.
C) carbonate rock.
D) sedimentary rock.
E) calcareous sand.

Question 10

Which of the following is NOT correct regarding conditions for life on Earth?

A) Generation of life requires continual input of energy.
B) The main source of energy for life is nuclear fusion reactions within the sun.
C) It depends on a temperature range permitting liquid water.
D) Life requires elements that lead to the formation of organic molecules.
E) Life requires a CO2-rich atmosphere.

Question 11

Which of the following is NOT correct about endolithic microorganisms?

A) They have been found in mines as deep as 3 kilometers.
B) Their discovery elicited interest in NASA scientists seeking life on Mars.
C) They can grow in Earth's core.
D) The term "endolithic" means living "within rocks."
E) They metabolize by oxidizing e- donors generated through decay of radioactive metals.

Question 12

The elements that formed initial microbial life originated from

A) oceans.
B) lightning.
C) supernovas.
D) the sun.
E) ozone.

Question 13

Molecular clocks use genes that

A) code for TCA cycle enzymes.
B) are found primarily on plasmid DNA.
C) are involved in transcription and translation.
D) are acquired through transduction.
E) encode enzymes for glycolysis.

Question 14

A clade could best be described as a

A) random but neutral DNA mutation.
B) hypothesis that early evolution happened faster than later evolution.
C) group of related organisms producing a monophyletic group.
D) hypothesis of how life began on Earth.
E) group of genes unselected for in evolution.

Question 15

The term "________" indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade.

A) monogamy
B) monophyletic group
C) polyphyletic group
D) monoploid
E) polyploid

Question 16

Which of the following did early methanogens use from the early atmosphere to generate energy?

A) CO2 and H2
B) H2O and O2
C) CH4 and CO2
D) N2 and O3
E) O2 and H2

Question 17

What are stromatolites?

A) fossil Nautilus shells formed by deposits of hydroxyapatite
B) FeO in banded iron formations
C) bulbous masses of layered CaCO3 accreted by microbial mats
D) accumulations of fossil trilobites
E) fossils from the Hadean eon

Question 18

Fossil stromatolites and microfossils are used as evidence in studies of early life on Earth. What is a disadvantage of using these rock formations in these types of studies?

A) Paleontologists have to dig deep into Earth's crust to find them.
B) Abiotic processes lead to the formation of stromatolite-like structures or objects that resemble microfossils.
C) They must be destroyed in order to obtain samples for analysis.
D) Their analysis requires expensive and inconvenient radioisotope detection.
E) They are extremely fragile when exposed to air.

Question 19

Which of the following is a highly speculative issue about the early origin of life?

A) Sufficient evidence exists that RNA might have been the first informational molecule.
B) Amino acids could have originated by Krebs cycle acids complexed to a dinucleotide.
C) Bacterial redox metabolism can be evidenced through 34S/32S ratios from 3.47 Gyr ago.
D) Ancestors of methanogens using H2 and CO2 to make CH4 and H2O evolved early.
E) Panspermia, life forms originated elsewhere, were seeded on Earth by meteorites.

Question 20

Which energy-production reactions were likely to have been present in the earliest cells?

A) glycolysis, Entner-Doudoroff pathway, and Krebs cycle
B) glycolysis, respiration, and bacteriochlorophyll-based photosynthesis
C) respiration and chlorophyll-based photosynthesis in PSI and PSII
D) oxidation-reduction, light-driven ion pumps, and methanogenesis
E) chemiosmosis, substrate-level phosphorylation, and oxygenic photosynthesis

Question 21

During the Long-Term Evolution Experiment (LTEE), investigators found a Cit⁺ strain of Escherichia coli that allowed fast growth on citrate buffer after 33,000 generations. The ability to catabolize citrate evolved at this time through

A) acquiring the ability to exploit new ecological niches.
B) becoming pathogens.
C) becoming dependant on a symbiotic partner's resources.
D) becoming pathogens and becoming dependent on a symbiotic partner's resources.
E) losing the ability to exploit new ecological niches.

Question 22

All of the following are examples of "operational genes," EXCEPT ________ genes.

A) metabolic
B) ribosomal RNA
C) stress response
D) pathogenicity
E) resistance

Question 23

Which branch of taxonomy deals with the sorting of life-forms into bins (categories) based on genetic relatedness and traits of the organisms?

A) identification
B) classification
C) nomenclature
D) biogeography
E) ethnology

Question 24

Which of the following is NOT used as a criterion to define a prokaryotic species?

A) Phylogenetic relatedness is not a criterion.
B) Members of different species cannot interbreed.
C) The average nucleotide identity (ANI) of orthologs ³ 95%.
D) Organisms with >95% identity have a shared ecotype.
E) SSU rRNA similarity ³ 95%.

Question 25

"Incompletely described," emerging organisms are on their way to be established as new species. In the meantime, they can be designated as all of the following EXCEPT a(n)

A) unclassified organism.
B) uncultured organism.
C) environmental sample
D) type species.
E) candidate species.

Question 26

Evidence in the study of adaptive evolution CANNOT be obtained from

A) comparisons of gene sequences within a genome.
B) comparisons of gene sequences between genomes.
C) the study of microorganisms growing in strongly selective environments.
D) sequencing a single genome several times (deep sequencing).
E) experimental evolution.

Question 27

Taxonomy can be defined as the

A) classifying of life forms into different categories with shared traits.
B) recognition of the class of a given microbe isolated in pure culture.
C) identification of a species in a sample or collection.
D) recognition of different classes of life.
E) testing of metabolic reactions to predict pathogenicity.

Question 28

In the domains of life, archaea and eukarya differ from each other in that archaea ________ and eukarya ________.

A) contain membrane-bound organelles; do not
B) do not undergo methanogenesis; do
C) do not contain membrane-bound organelles; do
D) are pathogenic to humans; are never pathogenic
E) have introns; do not

Question 29

The figure below shows two ways to represent phylogenetic relationships using rRNA from several thermophiles from Obsidian Pool in Yellowstone National Park. The principal advantage to unrooted trees, when compared to rooted trees, is that they

A) are more readable.
B) are easier to draw.
C) are more precise.
D) indicate the position of a common ancestor.
E) are more precise regarding mutation rates.

Question 30

The term "pan-genome" can best be defined as

A) the world DNA genomic databank.
B) the sum total of all expected genes in all possible isolates of a given species.
C) genomic islands found in pathogenic organisms.
D) the entire genomic sequence of all known organisms.
E) differences in RNA transcription between species.

Question 31

In the study of rapid adaptive evolution through exposure to strongly selective environments, the energy cost to an organism that emerges as the fittest is that it is

A) slowed by the demands of the stress response.
B) slowed as a result of decreasing respiratory activities.
C) slow growth as a result of impaired DNA replication.
D) uncontrolled growth due to an inability to regulate mRNA translation.
E) uncontrolled growth due to an inability to regulate binary fission.

Question 32

Based on small subunit rRNA phylogeny studies, the current view is that there are ________ domains of life.

A) two
B) three
C) four
D) five
E) six

Question 33

Horizontal gene transfer can occur by all of the following EXCEPT

A) plasmid acquisition.
B) transposable genetic elements.
C) bacteriophage infection.
D) transformation processes.
E) parent to offspring.

Question 34

What trait do all cells on Earth NOT have in common?

A) double-stranded DNA
B) cell wall of varying composition
C) universal gene code, common ancestral rRNAs, and elongation factors
D) common ancestral functional domains in proteins
E) cytoplasm, an aqueous compartment enclosed by a membrane

Question 35

In the domains of life, archaea and bacteria differ from each other in that

A) archaea contain membrane-bound organelles, bacteria do not.
B) bacteria can be extreme thermophiles, archaea cannot.
C) archaea contain ester-linked membrane fatty acids, bacteria do not.
D) bacteria start protein production with formylmethionine, archaea do not.
E) bacteria have introns, archaea do not.

Question 36

Which of the following would be considered a gene product of an "informational gene"?

A) Staphylococcus toxic shock toxin
B) siderophore transport protein
C) hexokinase enzyme for glycolysis
D) Escherichia coli O157:H7 attachment pili
E) 16S ribosomal RNA

Question 37

Appearance of a new trait in experimental evolution consists of which three basic stages?

A) fixing, staining, and decolorizing
B) disabling gene expression, regulation, slow cell growth
C) potentiation, actualization, and refinement
D) gene amplification, purification, and subcloning
E) restriction digestion, agarose gel electrophoresis, and staining

Question 38

Spikes in ________ content often indicate that a horizontal gene transfer has occurred in the genome.

A) GC
B) AC
C) GT
D) AT
E) CU

Question 39

Which of the following is the organizing body that sets the rules for naming a new prokaryotic species or taxa?

A) Bergey's Manual of Determinative Bacteriology
B) the International Committee on Systematics of Prokaryotes
C) the International Journal of Systematic and Evolutionary Microbiology
D) the American Society for Microbiology
E) the World Health Organization

Question 40

A dichotomous key is a

A) battery of biochemical tests used to identify organisms in a particular taxon.
B) detailed description of a taxon with diagnostic purposes.
C) registered valid name for a specific taxon.
D) comprehensive list of characteristics that define a taxonomic category.
E) series of yes/no choices that successively narrows down a possible taxonomic category.

Question 41

The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of

A) ectosymbiosis.
B) intracellular endosymbiosis.
C) parasitism.
D) commensalism.
E) competition.

Question 42

The following is correct about a probabilistic indicator for bacterial identification, EXCEPT that

A) it requires a predefined database of known bacteria.
B) numerous strains of each species in well-studied habitats must be isolated in pure culture and tested for a defined number of traits.
C) it is based on yes/no choices that successively narrow down the identification of a taxon.
D) it only works if the bacterial isolate coincides with a member of a predefined database.
E) fractions of positive results for certain traits are noted as the probability of obtaining a positive result.

Question 43

Explain how banded iron formations could arise in the geologic record due to photoferrotrophy.

Question 44

Refer to the figure below and briefly discuss the possible origin of the genetic code.

Question 45

Rhizobial bacteroids and their plant hosts have evolved to have what type of symbiotic relationship?

A) mutualistic
B) parasitic
C) commensal
D) ammensal
E) predatory

Question 46

The most likely ancestor for today's mitochondria according to the endosymbiotic model is a(n)

A) species in the genus Bacillus.
B) rickettsia.
C) member of the clostridia.
D) enterobacterium related to Escherichia coli.
E) cyanobacterium.

Question 47

Analyze the figure below. If a d ¹³C isotope analysis was performed on an unknown geological sample of sedimentary graphite and determined a negative d ¹³C % value, would it be determined that life had existed in that sample or not, and why?

Question 48

The disease filariasis is caused by the ________, which harbors Wolbachia endosymbionts.

A) flatworm Taenia solium
B) ciliate protist Paramecium bursaria
C) flagellate protist Guilladia theta
D) bacterium Staphylococcus aureus
E) nematode Brugia malayi

Question 49

Mitochondria maintained the essential genes ________ from the ancestral endosymbiont from which they evolved.

A) NADH dehydrogenase, cytochrome oxidase, and ATP synthetase
B) pyruvate dehydrogenase, citrate synthase, and fumarase
C) hexokinase, phosphoglucose isomerase, and phosphofructokinase
D) photosystem I and II and ATP synthetase
E) catalase, superoxide dismutase, and peroxidase

Question 50

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

Question 51

The word "symbiosis" is usually understood to mean ________, a relationship in which both partners benefit and may absolutely require each other.

A) comensalism
B) parasitism
C) mutualism
D) predation
E) competition

Question 52

Cyanobacterial endosymbionts in the protist ________retain cell walls and some metabolism, thus serving as a model for cyanobacterial uptake.

A) Paramecium bursaria
B) Paramecium aurelia
C) Cyanophora paradoxa
D) Glaucocystophyta sp.
E) Entamoeba hystolitica

Question 53

The figure below depicts a metabolist model for CO₂ fixation as the basis for biosynthesis as proposed by Morowitz and Wächterhäuser. Discuss the pathway and determine what its outcome is.

Question 54

Use the figure below to discuss how catalytic activity in enzyme proteins could have evolved from catalytic RNA.

Question 55

Briefly discuss the types of geological evidence of early life and their advantages and limitations.

Question 56

Explain how studying the evolutionary rate of RNA viruses in comparison to DNA viruses can help explain the evolutionary rate in early Earth.

Question 57

How do membrane compartments spontaneously arise from the properties of fatty acid glycerol esters?

Question 58

The ancestral organism that gave rise to the modern-day chloroplast was

A) rickettsia.
B) a cyanobacterium.
C) Wolbachia.
D) a rhizobial bacteroid.
E) a methanogen.

Question 59

Why and how is the gene for small subunit ribosomal RNA (SSU 16S rRNA) used to determine molecular phylogeny?

Question 60

Human diseases caused by defective mitochondrial DNA include all of the following EXCEPT

A) sickle cell anemia.
B) forms of ataxia.
C) dystonia.
D) Parkinson's disease.
E) chorea.

Question 61

How can plants be so efficient photosynthetically if the chloroplast genome has fewer genes when compared with free-living cyanobacteria?

Question 62

The figure below displays secondary symbiont alga Guillardia theta. Describe the process by which this relationship began.

Question 63

Why do bacterial antibiotics have a greater effect on diminishing the effects of nematode infection caused by Brugia malayi (the etiologic agent of filariasis) than current antinematode agents?

Question 64

Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a "closed" pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

Question 65

Use the figure below to describe the appearance of the Cit⁺ mutation in Escherichia coli during the Long-Term Evolution Experiment (LTEE).

Question 66

What criteria must be met in order to prove that two bacterial strains belong in the same species?

Question 67

Define the term "metagenomics" and explain why growth in this field has led to an increase in SSU rRNA species designations.

Question 68

Describe the intracellular endosymbiosis between algae of the genus Chlorella and Paramecium. Why is this symbiosis considered reversible?

Question 69

The Long-Term Evolution Experiment (LTEE) has been conducted by Richard Lenski at Michigan State University since 1988. The purpose of the experiment is to observe evolution in action in a laboratory environment. Use the figure below to explain what physiological adaptations allowed one of the Escherichia coli strains to grow to a much higher density after 33,000 generations.

Question 70

Discuss what horizontal gene transfer is. How does it occur and how might it obscure phylogenetic relationships among taxa?