Deck 10: How Genes Work

Question 1

The key enzyme used during transcription is

A) RNA polymerase.
B) DNA polymerase.
C) rRNA.
D) terminase.

Answer 1

A

Question 2

Which of the following is true of transcription?

A) It destroys the DNA template.
B) The DNA molecule must unwind.
C) Base pairing is unimportant.
D) The end result is a protein.

Answer 2

B

Question 3

Which of the following does NOT take place in the nucleus?

A) transcription
B) intron removal
C) DNA replication
D) translation

Answer 3

D

Question 4

As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

A) promoter.
B) intron.
C) start codon.
D) anticodon.

Question 5

DNA technology can be used with all organisms because they all

A) contain antibodies.
B) can contract the same diseases.
C) share the same chemical DNA structure.
D) contain the same genes.

Question 6

Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei.Therefore,prokaryotic

A) cells are unable to undergo transcription and translation.
B) cells do not need to undergo translation.
C) cells do not need to undergo transcription.
D) transcription and translation both take place in the cytoplasm.

Question 7

The bases present in an RNA molecule are

A) C, T, A, and G.
B) U, A, C, and G.
C) G, C, U, and T.
D) U, C, T, and A.

Question 8

Protein-coding genes specify the production of ________ as their immediate product.

A) rRNA
B) tRNA
C) DNA
D) mRNA

Question 9

During transcription,

A) the DNA strands replicate, producing four mRNA molecules.
B) each strand in the DNA molecule directs the production of an mRNA molecule.
C) a template strand of DNA directs the production of an mRNA molecule.
D) a template strand of DNA directs the production of a tRNA molecule.

Question 10

Bacteria and humans use the same DNA components,and both kinds of cells also perform transcription and translation.Which of the following choices is a potentially significant outcome of this shared mechanism?

A) Bacteria are able to transcribe and translate human DNA, and thus they potentially could produce human proteins.
B) Bacteria are able to transcribe and translate human DNA; thus, they could evolve into humans.
C) Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same.
D) Bacterial and human DNA are identical in sequence because the method for producing them is the same.

Question 11

A mutation occurs in the promoter of a protein-encoding gene.How might this mutation affect the production of the protein encoded by the gene?

A) The mRNA made from this gene would exhibit the same mutation and, therefore, would not fold or function properly.
B) The protein made from the promoter would have a different amino acid sequence and, therefore, would not function properly.
C) The promoter might not be recognized by RNA polymerase, so the enzyme would be unable to attach to the promoter and start transcription.
D) The start codon would be missing from the mRNA made from this gene, so the mRNA could not be translated.

Question 12

Some viruses produce an enzyme called reverse transcriptase which causes the reverse process of transcription.Based on your understanding of gene expression,this enzyme should produce ________ from a(n)________ template.

A) RNA; DNA
B) DNA; RNA
C) proteins; RNA
D) RNA; protein

Question 13

In bacteria,the antibiotic chloramphenicol prevents amino acids from bonding.The MOST likely reason that bacteria die from treatment with chloramphenicol is because the antibiotic

A) inhibits transcription.
B) inhibits translation.
C) causes the wrong bases to be added to the growing mRNA strand.
D) causes the wrong amino acids to be bound to the tRNA strands.

Question 14

The information in a gene is encoded by the

A) introns of eukaryotic cells.
B) amino acids that make up the genes.
C) base sequences of the gene's DNA.
D) rRNA that transfers amino acids to ribosomes.

Question 15

If a strand of DNA has the sequence CGTAA,the RNA made from this molecule will have the sequence

A) CGTAA.
B) GCUTT.
C) TAGCC.
D) GCAUU.

Question 16

The function of genes is to control the production of

A) enzymes.
B) structural proteins.
C) all proteins.
D) amino acids.

Question 17

In bacteria,the antibiotic erythromycin prevents ribosomes from functioning.The MOST likely reason that bacteria die from treatment with erythromycin is because the antibiotic

A) inhibits transcription.
B) inhibits translation.
C) causes the wrong bases to be added to the growing mRNA strand.
D) causes the wrong amino acids to be bound to the tRNA strands.

Question 18

The order of the bases in DNA determines the order of the

A) amino acids in DNA.
B) bases in a protein.
C) amino acids in mRNA.
D) bases in mRNA.

Question 19

Following transcription,the

A) strands of DNA bond back to each other.
B) mRNA is digested.
C) DNA molecule is broken down.
D) ribosome is released from the tRNA molecule.

Question 20

A human gene put into a plant cell will

A) not produce a protein.
B) produce a plant protein.
C) produce the same protein produced in a human cell.
D) produce a hybrid protein consisting of both human and plant components.

Question 21

Which of the following codons codes for proline?

A) UCC
B) CCU
C) UUU
D) CUU

Question 22

Which of the lettered arrows in the diagram below of translation indicates a codon?

A) A
B) B
C) C
D) D

Question 23

Which of the following is a codon?

A) U
B) UU
C) UUU
D) UUUU

Question 24

Which molecules are involved in translation?

A) DNA and RNA
B) mDNA, tDNA, and rDNA
C) mRNA, tRNA, and rRNA
D) proteins, amino acids, and DNA

Question 25

Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA?

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine

Question 26

Use the following chart to determine the chain of amino acids that would be produced by the entire mRNA sequence UGUACGAUAGGCUAG.

A) ACAUGCUAUAUCCCG
B) ACATGCTATATCCCG
C) cysteine-threonine-isoleucine-glycine
D) threonine-cysteine-tyrosine-isoleucine-proline

Question 27

Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation.In this analogy,what would best match the job of the ribosome?

A) the instructions
B) the person building the bookshelf
C) the pieces of wood
D) the bookshelf

Question 28

A smartphone app converts spoken English into Spanish.This is similar to the process by which ________ are converted into ________.

A) nitrogenous bases in DNA; nitrogenous bases in mRNA
B) nitrogenous bases in mRNA; a sequence of amino acids
C) amino acids in a protein; nitrogenous bases in tRNA
D) nitrogenous bases in tRNA; nitrogenous bases in mRNA

Question 29

Which of the following is true of rRNA?

A) It is made up of base pairs.
B) It carries amino acids.
C) It is not translated.
D) It helps transcribe DNA.

Question 30

Which of the following codons codes for the same amino acid as the codon AGU?

A) AGA
B) CGU
C) UCA
D) GCU

Question 31

What is the sequence of the codon to which the transfer RNA shown in the following figure would bind during translation?

A) UCG
B) AGC
C) TCC
D) Serine

Question 32

An mRNA molecule that is 99 bases long will create a protein composed of

A) 33 amino acids.
B) 99 amino acids.
C) 33 tRNA molecules.
D) 99 tRNA molecules.

Question 33

Which RNA molecule brings new amino acids to the growing protein chain in translation?

A) mRNA
B) tRNA
C) rRNA
D) dRNA

Question 34

The codon GAU codes for which amino acid?

A) CUA
B) CTA
C) aspartate
D) leucine

Question 35

The importance of tRNA is that it

A) carries a specific amino acid to the mRNA.
B) reads the DNA molecule.
C) contains codons that specify amino acids.
D) is important in the construction of ribosomes.

Question 36

During translation,

A) many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein.
B) one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein.
C) strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein.
D) one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.

Question 37

In bacteria,the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome.The MOST likely reason that bacteria die from treatment with tetracycline is because the antibiotic

A) inhibits the cell from producing the mRNA.
B) causes the tRNA molecules to randomly arrange into proteins that do not function.
C) causes tRNA rather than mRNA to be made into proteins.
D) prevents the bacteria from assembling essential proteins.

Question 38

Each set of three bases in an mRNA molecule codes for one of 20 specific

A) rRNA molecules.
B) nucleotides.
C) amino acids.
D) proteins.

Question 39

Which of the following codons does NOT code for an amino acid?

A) UGA
B) AUG
C) GAU
D) UAC

Question 40

In the genetic code,a codon is ________ bases long for ________.

A) two; all cell types
B) three; all cell types
C) three; bacterial cells and two bases long for plant cells
D) three; plant cells and three bases long for bacterial cells

Question 41

Which of the following is NOT a feature of the genetic code?

A) Every individual has a different genetic code.
B) Each codon in the genetic code specifies only one amino acid.
C) The genetic code is redundant.
D) The same genetic code can be applied to virtually every organism on Earth.

Question 42

Gene expression is

A) nonvariable for cells; it is the same for all cells of the same type.
B) highly variable; it changes for many different reasons throughout the life of a cell.
C) set by internal factors early in the life cycle of a cell and remains the same from that point forward.
D) set by external factors early in the life cycle of a cell and remains the same from that point forward.

Question 43

In humans the tRNA with the anticodon AAU carries the amino acid leucine.In plants,this tRNA would

A) not have an anticodon.
B) not carry an amino acid.
C) carry the same amino acid.
D) carry a different amino acid.

Question 44

If a molecule of mRNA is a sentence,its bases are the letters and the codons are the ________.

Question 45

Gene regulation is the ability to

A) cut out a certain region of DNA to save energy.
B) increase or decrease protein synthesis from a given gene.
C) change the sequence of a gene to produce a new protein.
D) share genetic information between different organisms.

Question 46

Transforming plants with a human gene produces a protein that is identical to the original human protein.Explain how this evidence demonstrates that the genetic code is universal,and list another experiment that could be used to further support this theory.

Question 47

The expression of most genes is regulated by

A) internal signals only.
B) external signals only.
C) both internal and external signals.
D) neither internal nor external signals.

Question 48

In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result,

A) more mRNA for aromatase is produced.
B) less mRNA for aromatase is produced.
C) the production of aromatase is inhibited.
D) aromatase is degraded by other enzymes in the cell.

Question 49

A gene in a region of DNA that is wound more tightly around proteins in the nucleus will be

A) transcribed more often than other genes.
B) transcribed less often than other genes.
C) transcribed equally as often as any other gene.
D) digested and recycled to produce new DNA.

Question 50

A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end.This molecule is most likely a ________ molecule.

Question 51

A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.

Question 52

The process of using an RNA template to make proteins is called ________.

Question 53

A tRNA with the anticodon GGG would have the amino acid ________ bound to it.

Question 54

A mutation in the promoter region of a specific gene prevents RNA polymerase from binding.How would this mutation affect the function of this gene?

Question 55

Liver cells are different from heart cells of the same organism because these cell types

A) have different genes.
B) express different genes.
C) have a different DNA sequence.
D) mutated from a stem cell to produce new cell types.

Question 56

The genetic code is ________,which means that all cells use the same code.

Question 57

In bacteria,a particular gene codes for a protein that helps the bacteria break down and use lactose as a food source.If no lactose is present,the

A) gene will be broken down, so no enzyme is made.
B) gene will mutate to produce another, more useful, enzyme.
C) promoter for this gene will be blocked, so RNA polymerase can't bind.
D) promoter for this gene will be enhanced, so RNA polymerase binds more readily.

Question 58

Explain how different cells in a human body,such as liver cells and skin cells,house the same genetic material but have different functions.

Question 59

Since 1900,at least ________ people worldwide have died as a result of an H1N1 influenza infection.

A) 50,000,000
B) 50,285,000
C) 650,000
D) 52,535,000

Question 60

DNA viruses cause disease when the host cell uses the viral DNA to produce more viruses.The host cell uses the viral DNA to make viral proteins as well as more viral DNA; these are then used to produce more viruses and cause disease.In a eukaryotic cell,the viral DNA is often inserted into the host genome.Explain why viral DNA that stays in the cytoplasm would not cause disease.

Question 61

MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
More ribosomes are produced.

Question 62

Explain what is meant by "redundancy" in the genetic code.

Question 63

Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.

Question 64

One concern with biopharming is that genes used to produce desired proteins could "escape" a laboratory setting and spread to food crops.What does it mean for a gene to "escape?" How would food crops be affected?

Question 65

Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
mRNA

Question 66

A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?

Question 67

MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
The mRNA molecules are broken down quickly in the cytoplasm.

Question 68

MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
Fewer RNA polymerase enzymes are produced.

Question 69

Organisms can regulate both transcription and translation to control gene expression.What is one advantage and one disadvantage of regulating transcription rather than translation?

Question 70

MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
RNA polymerase binds to the promoter more easily.

Question 71

Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
RNA polymerase

Question 72

MATCHING
Identify if the following situations represent an increase or decrease in transcription or translation.
a.Transcription is up-regulated.b.Transcription is down-regulated.c.Translation is up-regulated.d.Translation is down-regulated.
Fewer tRNA molecules are produced.

Question 73

A silent mutation is a mutation where a DNA nucleotide has changed,but the resulting protein is identical to the protein produced before the mutation.Explain why such a mutation is possible.

Question 74

Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
amino acids

Question 75

Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
tRNA

Question 76

Translate the following DNA sequence into a sequence of amino acids: TACTAAGGA.

Question 77

Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
rRNA

Question 78

Determine whether each molecule plays a role in transcription,translation,or both.
a.transcription c.both transcription and translation
b.translation
DNA

Question 79

Bacteria do not have a nucleus,and therefore do not use RNA splicing after translation.The initial mRNA that is produced is translated directly.An experiment transforms a bacterial cell and a eukaryotic cell with an identical gene (of identical length).Explain how the proteins from each cell would differ.

Question 80

A mutation that changes the anticodon of a tRNA is generally much more detrimental to a cell than a mutation that changes the codon of an mRNA.Explain why this might be the case.