Deck 12: DNA Technology

ملء الشاشة (f)
exit full mode
سؤال
Which of the following is a genetically modified organism?

A)an organism carrying a gene that was acquired by artificial means
B)the first organism in which a particular mutation has appeared
C)a cloned organism carrying two different alleles
D)an organism that gestated in an artificial womb
استخدم زر المسافة أو
up arrow
down arrow
لقلب البطاقة.
سؤال
The world's first genetically engineered pharmaceutical product was ________.

A)humulin
B)HGH
C)tPA
D)EPO
سؤال
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

A)0 times
B)1 time
C)2 times
D)3 times
سؤال
"Sticky ends" are ________.

A)single-stranded ends of fragments of double-stranded DNA
B)regions of double-stranded DNA that can be cut by a restriction enzyme
C)portions of DNA used as markers for STR analysis
D)regions of DNA amplified in PCR
سؤال
The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

A)gene cloning
B)PCR
C)STR analysis
D)whole-genome shotgun method
سؤال
Which of the following can act as a vector to introduce new genes into a cell?

A)primers
B)ligase
C)restriction enzymes
D)plasmids
سؤال
A vaccine works by ________.

A)inhibiting bacterial reproduction
B)stimulating the immune system to develop lasting defenses
C)killing cells infected with a virus
D)preventing translation of mRNA molecules that code for disease-causing proteins
سؤال
You are attempting to link an individual to a crime.The only evidence you have is a tiny drop of blood.How can you use this drop of blood to definitively make the association?

A)You can use the sample to determine the individual's blood type.
B)You can use gel electrophoresis to determine the length of the DNA found in the sample.
C)You can use PCR to increase the amount of DNA available for STR analysis.
D)You can use the sample to check for the presence of the Rhesus factor.
سؤال
Transgenic animals are currently used ________.

A)to produce potentially useful proteins
B)as food
C)as vectors for use in cloning human DNA
D)all of the answer options are correct
سؤال
Which of the following best defines the term "transgenic organism"?

A)an organism that is the first of its kind to bear a particular allele
B)an organism in which a genetic defect has been corrected using recombinant DNA therapy
C)an organism containing a gene from another species
D)an organism containing genes from three or more species
سؤال
A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ________.

A)TAAGC-
B)CGGAT-
C)GCCTA-
D)ATTGC-
سؤال
Of the following,which is the last step in the production of a recombinant DNA plasmid?

A)cloning
B)using DNA ligase to join DNA fragments
C)cutting the gene of interest into fragments
D)allowing the reproduction of the bacterium bearing the recombinant plasmid
سؤال
When plasmids are used to produce a desired protein,the ________.

A)plasmids multiply and produce the protein outside of the bacterium
B)bacterial chromosome is genetically engineered,and the plasmid is used to help the bacterium replicate
C)desired gene is inserted into the plasmid,and the plasmid is taken up by the bacterium
D)bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene
سؤال
Restriction enzymes are obtained from ________.

A)archaea
B)eukaryotes
C)viruses
D)bacteria
سؤال
Which of the following is the best definition for recombinant DNA?

A)DNA that results from bacterial conjugation
B)DNA that includes pieces from two different sources
C)an alternate form of DNA that is the product of a mutation
D)DNA that carries a translocation
سؤال
Of these steps,which occurs first in the production of a recombinant plasmid?

A)cloning
B)cutting DNA into fragments
C)isolation of a plasmid from a bacterium
D)reproduction of the engineered plasmid in bacteria
سؤال
Which enzyme is used to bind DNA fragments together?

A)restriction enzyme
B)lysozyme
C)DNA ligase
D)DNA polymerase
سؤال
Of these steps,which one occurs earliest in the process of producing recombinant DNA?

A)Human DNA fragments are mixed with the cut plasmids.
B)The same restriction enzyme is used to isolate the gene of interest and to cut the plasmid DNA.
C)The recombinant plasmids are mixed with bacteria.
D)Bacteria carrying recombinant plasmids are cloned.
سؤال
What evidence led to Kirk Odom's freedom after being wrongly imprisoned for 30 years?

A)an analysis of blood types from the crime scene
B)an analysis of fingerprints from the crime scene
C)accounts from witnesses
D)an analysis of DNA from the crime scene
سؤال
"Sticky ends" are produced as a result of the action of ________.

A)PCR
B)DNA ligase
C)restriction enzymes
D)bacterial plasmids
سؤال
STR analysis is a DNA profiling technique that makes use of the fact that different people have ________.

A)different numbers of repeats of short DNA sequences at certain sites in the genome
B)different alleles for many genes in the genome
C)different restriction fragments
D)different CODIS DNA sequences
سؤال
The Human Genome Project has the potential to ________.

A)lead to treatments for inherited diseases
B)lead to treatments for contagious diseases
C)increase our understanding of the historical relationships among species
D)play a role in all of the choices listed here
سؤال
Gel electrophoresis separates DNA fragments on the basis of differences in their ________.

A)A:C ratio
B)length
C)G:T ratio
D)pH
سؤال
Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________.

A)gel electrophoresis
B)enzymes
C)recombinant DNA
D)plasmids
سؤال
The scientific field that studies complete sets of genes is called ________.

A)genomics
B)metagenomics
C)proteomics
D)genetic engineering
سؤال
To make restriction fragments,a DNA sample is treated with ________.

A)DNA ligase
B)restriction enzymes
C)DNA polymerase
D)lysozyme
سؤال
Ethical dilemmas raised by DNA technology and knowledge of the human genome include ________.

A)the potential for interfering in evolution,only
B)the safety of GM foods,only
C)the potential discrimination against people predisposed to certain diseases,only
D)all of the answer choices are correct
سؤال
Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

A)Humans and chimpanzees share a relatively recent common ancestor.
B)Humans evolved from chimpanzees.
C)Humans are unique and different from all other life forms.
D)Humans are a more complex life form than chimpanzees.
سؤال
In human gene therapy ________.

A)normal versions of genes are transferred to patients who carry a mutated allele
B)harmless bacteria make important proteins for humans that cannot produce these proteins on their own
C)bacterial plasmids are used to transfer genes to human patients
D)genetically engineered alleles,usually from other species,replace mutated alleles
سؤال
The possibility that Mongolian ruler Genghis Khan spread an unusual chromosome to nearly 16 million men living today resulted from studies of ________.

A)proteomics
B)plasmids
C)the X chromosome
D)the Y chromosome
سؤال
FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

A)FGA varies in the number of repeats between different people.
B)FGA varies in sequence between different people.
C)FGA is only present in some peoples' genomes.
D)FGA is present in different places in different peoples' genomes.
سؤال
The human genome contains approximately ________ genes.

A)1,000
B)5,000
C)21,000
D)30,000
سؤال
The state of human gene therapy today is that ________.

A)the work that has been completed so far is purely theoretical,but some treatments are in development
B)there have been a small number of successes,including with the disease SCID
C)human gene therapy is used routinely in the treatment of certain rare cancers
D)human gene therapy is used to treat a wide variety of conditions,including diabetes,cancer,and bone marrow diseases
سؤال
What name is given to a region of DNA that varies from person to person?

A)genetic marker
B)short tandem repeat
C)sticky end
D)restriction fragment
سؤال
Approximately what percentage of the human genome consists of noncoding DNA?

A)98%
B)87%
C)77%
D)67%
سؤال
The study of the full protein sets that genomes encode is ________.

A)proteomics
B)genomics
C)metagenomics
D)systems biology
سؤال
The following figure shows that gel electrophoresis can be used to separate repetitive DNA sequences.Gel electrophoresis separates DNA fragments because ________. <strong>The following figure shows that gel electrophoresis can be used to separate repetitive DNA sequences.Gel electrophoresis separates DNA fragments because ________.  </strong> A)double-stranded moves slower than single-stranded DNA B)of ratios of guanine to cytosine C)the DNA fragments have different lengths D)of the salt concentration in the gel matrix <div style=padding-top: 35px>

A)double-stranded moves slower than single-stranded DNA
B)of ratios of guanine to cytosine
C)the DNA fragments have different lengths
D)of the salt concentration in the gel matrix
سؤال
Genetically modifying human ________ cells may directly affect future generations.

A)intestinal
B)immune
C)gametic
D)somatic
سؤال
To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

A)centrifuged and electrophoresed
B)fingerprinted
C)cloned and sequenced
D)restricted
سؤال
The following figure provides you with an overview of recombinant technology.The end result is a transgenic bacterium with a human gene that codes for marketable quantities of a human gene product.However,molecular biologists frequently have problems with the product.One problem might be ________. <strong>The following figure provides you with an overview of recombinant technology.The end result is a transgenic bacterium with a human gene that codes for marketable quantities of a human gene product.However,molecular biologists frequently have problems with the product.One problem might be ________.  </strong> A)production of a human protein that is unable to function properly B)formation of a bacterium that cannot synthesize the product C)a bacterium with DNA that is resistant to restriction enzymes D)formation of mutants <div style=padding-top: 35px>

A)production of a human protein that is unable to function properly
B)formation of a bacterium that cannot synthesize the product
C)a bacterium with DNA that is resistant to restriction enzymes
D)formation of mutants
سؤال
The results indicate that ________.

A)she is not the mother of the son
B)she is the mother of daughter D
C)she is not the mother of daughter D
D)the mother could not be the mother of both the daughter and the son
سؤال
The diagram below summarizes ________. <strong>The diagram below summarizes ________.  </strong> A)gene cloning B)how a human could be cloned C)human gene therapy D)how a vaccine is made <div style=padding-top: 35px>

A)gene cloning
B)how a human could be cloned
C)human gene therapy
D)how a vaccine is made
سؤال
What can you conclude from the data in the graph?

A)Corn borers are less likely to survive if they eat Bt corn compared to non-Bt corn.
B)Mites have the highest percent mortality of the arthropods studied.
C)Beetles are more likely to survive than mites when fed Bt corn.
D)Bt corn affects the mortality of all three arthropods equally.
سؤال
The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to

A)DNA molecule A
B)DNA molecule B
C)DNA molecule C
D)DNA molecule D
D))Which DNA molecule is the largest?
سؤال
The short tandem repeat analysis ________.

A)compares markers on the sex chromosomes
B)compares repetitive DNA sequences from different individuals
C)does not require DNA amplification
D)checks for purine and pyrimidine ratios
سؤال
The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to

A)250 nucleotides
B)300 nucleotides
C)350 nucleotides
D)400 nucleotides
D))What is the approximate size of DNA molecule A?
سؤال
You can use this DNA fingerprinting information to make a judgment about maternity because ________.

A)the shade of DNA bands will differ
B)both mother and daughter contain only X chromosomes
C)of the position of the bands in the gel
D)of the size of the bands
سؤال
One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

A)Yes,because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer.
B)Yes,because only the corn borer was affected when eating the Bt corn.
C)No,because more mites and beetles died after eating Bt corn than after eating non-Bt corn.
D)No,because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt.
سؤال
Based on the data in the graph,do you think Bt corn is having its intended effect?

A)Yes,because Bt corn affected the mortality of all three arthropods equally.
B)Yes,because Bt corn selectively killed corn borers that ate it while the beetles and mites were unaffected when eating the Bt corn as compared to the non-Bt corn.
C)No,because Bt corn was designed to kill all arthropods that ate it,and only the corn borers were killed after eating the Bt corn.
D)No,because corn borer percent mortality increased when corn borers ate Bt corn; if Bt corn was effective,then percent mortality should have decreased.
سؤال
STR analysis can also be used for crime scene investigations in addition to maternity testing.Suppose that the results for the Mom were found at a crime scene,that the daughter's and the son's results were from possible suspects,and that each of the DNA markers in the gel was an STR marker.Would these results be enough to convince a jury that the results from the daughter matched the crime scene DNA (Mom)?

A)Yes,because the two STR markers match in size.
B)Yes,because you need only one STR marker to match to definitely make a connection between two people's DNA.
C)No,because even though two STR markers matched,there still could be mismatches in the other 11 markers.
D)No,because blood-typing data analysis was not performed.
فتح الحزمة
قم بالتسجيل لفتح البطاقات في هذه المجموعة!
Unlock Deck
Unlock Deck
1/50
auto play flashcards
العب
simple tutorial
ملء الشاشة (f)
exit full mode
Deck 12: DNA Technology
1
Which of the following is a genetically modified organism?

A)an organism carrying a gene that was acquired by artificial means
B)the first organism in which a particular mutation has appeared
C)a cloned organism carrying two different alleles
D)an organism that gestated in an artificial womb
A
2
The world's first genetically engineered pharmaceutical product was ________.

A)humulin
B)HGH
C)tPA
D)EPO
A
3
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

A)0 times
B)1 time
C)2 times
D)3 times
C
4
"Sticky ends" are ________.

A)single-stranded ends of fragments of double-stranded DNA
B)regions of double-stranded DNA that can be cut by a restriction enzyme
C)portions of DNA used as markers for STR analysis
D)regions of DNA amplified in PCR
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
5
The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

A)gene cloning
B)PCR
C)STR analysis
D)whole-genome shotgun method
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
6
Which of the following can act as a vector to introduce new genes into a cell?

A)primers
B)ligase
C)restriction enzymes
D)plasmids
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
7
A vaccine works by ________.

A)inhibiting bacterial reproduction
B)stimulating the immune system to develop lasting defenses
C)killing cells infected with a virus
D)preventing translation of mRNA molecules that code for disease-causing proteins
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
8
You are attempting to link an individual to a crime.The only evidence you have is a tiny drop of blood.How can you use this drop of blood to definitively make the association?

A)You can use the sample to determine the individual's blood type.
B)You can use gel electrophoresis to determine the length of the DNA found in the sample.
C)You can use PCR to increase the amount of DNA available for STR analysis.
D)You can use the sample to check for the presence of the Rhesus factor.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
9
Transgenic animals are currently used ________.

A)to produce potentially useful proteins
B)as food
C)as vectors for use in cloning human DNA
D)all of the answer options are correct
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
10
Which of the following best defines the term "transgenic organism"?

A)an organism that is the first of its kind to bear a particular allele
B)an organism in which a genetic defect has been corrected using recombinant DNA therapy
C)an organism containing a gene from another species
D)an organism containing genes from three or more species
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
11
A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ________.

A)TAAGC-
B)CGGAT-
C)GCCTA-
D)ATTGC-
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
12
Of the following,which is the last step in the production of a recombinant DNA plasmid?

A)cloning
B)using DNA ligase to join DNA fragments
C)cutting the gene of interest into fragments
D)allowing the reproduction of the bacterium bearing the recombinant plasmid
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
13
When plasmids are used to produce a desired protein,the ________.

A)plasmids multiply and produce the protein outside of the bacterium
B)bacterial chromosome is genetically engineered,and the plasmid is used to help the bacterium replicate
C)desired gene is inserted into the plasmid,and the plasmid is taken up by the bacterium
D)bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
14
Restriction enzymes are obtained from ________.

A)archaea
B)eukaryotes
C)viruses
D)bacteria
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
15
Which of the following is the best definition for recombinant DNA?

A)DNA that results from bacterial conjugation
B)DNA that includes pieces from two different sources
C)an alternate form of DNA that is the product of a mutation
D)DNA that carries a translocation
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
16
Of these steps,which occurs first in the production of a recombinant plasmid?

A)cloning
B)cutting DNA into fragments
C)isolation of a plasmid from a bacterium
D)reproduction of the engineered plasmid in bacteria
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
17
Which enzyme is used to bind DNA fragments together?

A)restriction enzyme
B)lysozyme
C)DNA ligase
D)DNA polymerase
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
18
Of these steps,which one occurs earliest in the process of producing recombinant DNA?

A)Human DNA fragments are mixed with the cut plasmids.
B)The same restriction enzyme is used to isolate the gene of interest and to cut the plasmid DNA.
C)The recombinant plasmids are mixed with bacteria.
D)Bacteria carrying recombinant plasmids are cloned.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
19
What evidence led to Kirk Odom's freedom after being wrongly imprisoned for 30 years?

A)an analysis of blood types from the crime scene
B)an analysis of fingerprints from the crime scene
C)accounts from witnesses
D)an analysis of DNA from the crime scene
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
20
"Sticky ends" are produced as a result of the action of ________.

A)PCR
B)DNA ligase
C)restriction enzymes
D)bacterial plasmids
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
21
STR analysis is a DNA profiling technique that makes use of the fact that different people have ________.

A)different numbers of repeats of short DNA sequences at certain sites in the genome
B)different alleles for many genes in the genome
C)different restriction fragments
D)different CODIS DNA sequences
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
22
The Human Genome Project has the potential to ________.

A)lead to treatments for inherited diseases
B)lead to treatments for contagious diseases
C)increase our understanding of the historical relationships among species
D)play a role in all of the choices listed here
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
23
Gel electrophoresis separates DNA fragments on the basis of differences in their ________.

A)A:C ratio
B)length
C)G:T ratio
D)pH
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
24
Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________.

A)gel electrophoresis
B)enzymes
C)recombinant DNA
D)plasmids
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
25
The scientific field that studies complete sets of genes is called ________.

A)genomics
B)metagenomics
C)proteomics
D)genetic engineering
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
26
To make restriction fragments,a DNA sample is treated with ________.

A)DNA ligase
B)restriction enzymes
C)DNA polymerase
D)lysozyme
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
27
Ethical dilemmas raised by DNA technology and knowledge of the human genome include ________.

A)the potential for interfering in evolution,only
B)the safety of GM foods,only
C)the potential discrimination against people predisposed to certain diseases,only
D)all of the answer choices are correct
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
28
Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

A)Humans and chimpanzees share a relatively recent common ancestor.
B)Humans evolved from chimpanzees.
C)Humans are unique and different from all other life forms.
D)Humans are a more complex life form than chimpanzees.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
29
In human gene therapy ________.

A)normal versions of genes are transferred to patients who carry a mutated allele
B)harmless bacteria make important proteins for humans that cannot produce these proteins on their own
C)bacterial plasmids are used to transfer genes to human patients
D)genetically engineered alleles,usually from other species,replace mutated alleles
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
30
The possibility that Mongolian ruler Genghis Khan spread an unusual chromosome to nearly 16 million men living today resulted from studies of ________.

A)proteomics
B)plasmids
C)the X chromosome
D)the Y chromosome
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
31
FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

A)FGA varies in the number of repeats between different people.
B)FGA varies in sequence between different people.
C)FGA is only present in some peoples' genomes.
D)FGA is present in different places in different peoples' genomes.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
32
The human genome contains approximately ________ genes.

A)1,000
B)5,000
C)21,000
D)30,000
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
33
The state of human gene therapy today is that ________.

A)the work that has been completed so far is purely theoretical,but some treatments are in development
B)there have been a small number of successes,including with the disease SCID
C)human gene therapy is used routinely in the treatment of certain rare cancers
D)human gene therapy is used to treat a wide variety of conditions,including diabetes,cancer,and bone marrow diseases
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
34
What name is given to a region of DNA that varies from person to person?

A)genetic marker
B)short tandem repeat
C)sticky end
D)restriction fragment
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
35
Approximately what percentage of the human genome consists of noncoding DNA?

A)98%
B)87%
C)77%
D)67%
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
36
The study of the full protein sets that genomes encode is ________.

A)proteomics
B)genomics
C)metagenomics
D)systems biology
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
37
The following figure shows that gel electrophoresis can be used to separate repetitive DNA sequences.Gel electrophoresis separates DNA fragments because ________. <strong>The following figure shows that gel electrophoresis can be used to separate repetitive DNA sequences.Gel electrophoresis separates DNA fragments because ________.  </strong> A)double-stranded moves slower than single-stranded DNA B)of ratios of guanine to cytosine C)the DNA fragments have different lengths D)of the salt concentration in the gel matrix

A)double-stranded moves slower than single-stranded DNA
B)of ratios of guanine to cytosine
C)the DNA fragments have different lengths
D)of the salt concentration in the gel matrix
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
38
Genetically modifying human ________ cells may directly affect future generations.

A)intestinal
B)immune
C)gametic
D)somatic
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
39
To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

A)centrifuged and electrophoresed
B)fingerprinted
C)cloned and sequenced
D)restricted
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
40
The following figure provides you with an overview of recombinant technology.The end result is a transgenic bacterium with a human gene that codes for marketable quantities of a human gene product.However,molecular biologists frequently have problems with the product.One problem might be ________. <strong>The following figure provides you with an overview of recombinant technology.The end result is a transgenic bacterium with a human gene that codes for marketable quantities of a human gene product.However,molecular biologists frequently have problems with the product.One problem might be ________.  </strong> A)production of a human protein that is unable to function properly B)formation of a bacterium that cannot synthesize the product C)a bacterium with DNA that is resistant to restriction enzymes D)formation of mutants

A)production of a human protein that is unable to function properly
B)formation of a bacterium that cannot synthesize the product
C)a bacterium with DNA that is resistant to restriction enzymes
D)formation of mutants
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
41
The results indicate that ________.

A)she is not the mother of the son
B)she is the mother of daughter D
C)she is not the mother of daughter D
D)the mother could not be the mother of both the daughter and the son
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
42
The diagram below summarizes ________. <strong>The diagram below summarizes ________.  </strong> A)gene cloning B)how a human could be cloned C)human gene therapy D)how a vaccine is made

A)gene cloning
B)how a human could be cloned
C)human gene therapy
D)how a vaccine is made
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
43
What can you conclude from the data in the graph?

A)Corn borers are less likely to survive if they eat Bt corn compared to non-Bt corn.
B)Mites have the highest percent mortality of the arthropods studied.
C)Beetles are more likely to survive than mites when fed Bt corn.
D)Bt corn affects the mortality of all three arthropods equally.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
44
The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to

A)DNA molecule A
B)DNA molecule B
C)DNA molecule C
D)DNA molecule D
D))Which DNA molecule is the largest?
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
45
The short tandem repeat analysis ________.

A)compares markers on the sex chromosomes
B)compares repetitive DNA sequences from different individuals
C)does not require DNA amplification
D)checks for purine and pyrimidine ratios
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
46
The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to

A)250 nucleotides
B)300 nucleotides
C)350 nucleotides
D)400 nucleotides
D))What is the approximate size of DNA molecule A?
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
47
You can use this DNA fingerprinting information to make a judgment about maternity because ________.

A)the shade of DNA bands will differ
B)both mother and daughter contain only X chromosomes
C)of the position of the bands in the gel
D)of the size of the bands
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
48
One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

A)Yes,because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer.
B)Yes,because only the corn borer was affected when eating the Bt corn.
C)No,because more mites and beetles died after eating Bt corn than after eating non-Bt corn.
D)No,because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
49
Based on the data in the graph,do you think Bt corn is having its intended effect?

A)Yes,because Bt corn affected the mortality of all three arthropods equally.
B)Yes,because Bt corn selectively killed corn borers that ate it while the beetles and mites were unaffected when eating the Bt corn as compared to the non-Bt corn.
C)No,because Bt corn was designed to kill all arthropods that ate it,and only the corn borers were killed after eating the Bt corn.
D)No,because corn borer percent mortality increased when corn borers ate Bt corn; if Bt corn was effective,then percent mortality should have decreased.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
50
STR analysis can also be used for crime scene investigations in addition to maternity testing.Suppose that the results for the Mom were found at a crime scene,that the daughter's and the son's results were from possible suspects,and that each of the DNA markers in the gel was an STR marker.Would these results be enough to convince a jury that the results from the daughter matched the crime scene DNA (Mom)?

A)Yes,because the two STR markers match in size.
B)Yes,because you need only one STR marker to match to definitely make a connection between two people's DNA.
C)No,because even though two STR markers matched,there still could be mismatches in the other 11 markers.
D)No,because blood-typing data analysis was not performed.
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.
فتح الحزمة
k this deck
locked card icon
فتح الحزمة
افتح القفل للوصول البطاقات البالغ عددها 50 في هذه المجموعة.