Deck 12: From Gene to Protein

Question 1

Which of the following is true of transcription?

A) It destroys the DNA template.
B) The DNA molecule must unwind.
C) Base pairing is unimportant.
D) The end result is a protein.

Answer 1

B

Question 2

The sequence of nucleotides in an mRNA molecule

A) is complementary to the DNA template strand.
B) matches the sequence of the ribosome that will translate the mRNA.
C) exactly matches the template strand (except where U is substituted for T).
D) is identical to that of the promoter.

Answer 2

A

Question 3

A promoter would be located on

A) the template strand of a DNA molecule.
B) the anticodon of a tRNA molecule.
C) an mRNA molecule.
D) RNA polymerase.

Answer 3

A

Question 4

As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

A) promoter.
B) intron.
C) start codon.
D) anticodon.

Question 5

Prokaryotes lack membrane-bound organelles and thus do not have nuclei;therefore

A) prokaryotes are unable to undergo transcription and translation.
B) prokaryotic cells do not need to undergo translation.
C) prokaryotic transcription and translation both take place in the cytoplasm.
D) prokaryotes are unable to replicate their DNA.

Question 6

Following transcription,the

A) strands of DNA bond back to each other.
B) mRNA is digested.
C) DNA molecule is broken down.
D) ribosome is released from the tRNA molecule.

Question 7

Which of the following is true of rRNA?

A) It is made up of base pairs.
B) It carries amino acids.
C) It is not translated.
D) It helps transcribe DNA.

Question 8

Which of the following would be found only in RNA?

A) deoxyribose and uracil
B) ribose and thymine
C) ribose and uracil
D) deoxyribose and thymine

Question 9

The sugar molecule present in RNA is

A) uracil.
B) deoxyribose.
C) ribose.
D) sucrose.

Question 10

Which of the following does NOT take place in the nucleus?

A) transcription
B) RNA splicing
C) replication
D) translation

Question 11

Protein coding genes specify the manufacture of ________ as their immediate product.

A) rRNA
B) tRNA
C) DNA
D) mRNA

Question 12

During transcription

A) the DNA strands replicate,producing four mRNA molecules.
B) each strand in the DNA molecule directs the production of an mRNA molecule.
C) a template strand of DNA directs the production of an mRNA molecule.
D) a template strand of DNA directs only the production of all the tRNA molecules needed for producing the gene's protein product.

Question 13

The information in a gene is encoded by the

A) introns of eukaryotic cells.
B) amino acids that make up the genes.
C) base sequences of the gene's DNA.
D) rRNA that transfers amino acids to ribosomes.

Question 14

Which of the following is the best and most complete description of the function of genes?

A) They control the production of enzymes.
B) They control the production of structural proteins.
C) They control the production of all proteins.
D) They control the production of amino acids.

Question 15

How does a molecule of RNA polymerase "know" which of the two strands of DNA it should use as a template strand?

A) RNA polymerase recognizes the start codon.
B) RNA polymerase binds to the promoter in a specific orientation that determines which DNA strand it will be able to "read."
C) The ribosome binds to the promoter in a specific orientation that determines which DNA strand it will be able to "read."
D) RNA polymerase binds randomly to one strand or the other,so that roughly half of its attachments to DNA result in the production of the correct mRNA.

Question 16

The bases present in an RNA molecule are

A) C,T,A,and G.
B) U,A,C,and G.
C) G,C ,U,and T.
D) U,C,T,and A.

Question 17

If a strand of DNA has the sequence CGTAA,the mRNA made from this molecule will have the sequence

A) CGTAA.
B) GCUTT.
C) TAGCC.
D) GCAUU.

Question 18

The order of the bases in DNA determines the order of the

A) amino acids in DNA.
B) bases in a protein.
C) amino acids in mRNA.
D) bases in mRNA.

Question 19

The key enzyme used during transcription is

A) RNA polymerase.
B) DNA polymerase.
C) rRNA.
D) terminase.

Question 20

DNA molecules are double-stranded,whereas most RNA molecules are single-stranded.Which of the following choices is the most likely reason that RNA does NOT need to be double-stranded?

A) DNA reproduces itself directly,whereas RNA does not.
B) RNA reproduces itself directly,whereas DNA does not.
C) DNA undergoes translation that requires the use of both strands at the same time.
D) RNA undergoes transcription that can only read one strand at a time.

Question 21

Which molecules are involved in translation?

A) DNA and RNA
B) mDNA,tDNA,and rDNA
C) mRNA,tRNA,and rRNA
D) proteins,amino acids,and DNA

Question 22

The importance of tRNA is that it

A) carries a specific amino acid to the mRNA and the ribosome.
B) reads the DNA molecule.
C) contains codons that specify amino acids.
D) is important in the construction of ribosomes.

Question 23

Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG?

A) ACAUGCUAUAUCCCG
B) ACATGCTATATCCCG
C) cysteine-threonine-isoleucine-glycine
D) cysteine-threonine-isoleucine-glycine-stop

Question 24

Which of the lettered arrows in the following diagram of translation indicates a codon?

A) A
B) B
C) C
D) D

Question 25

A chemical that causes the formation of covalent bonds between adenines and thymines on opposite DNA strands is added to a cell in such a way that the bonds between the nucleotides cannot be broken.How does this drug affect gene expression in the cell?

A) The chemical increases the efficiency of protein production by making it easier for tRNA to interact with the correct mRNA codons.
B) The chemical prevents transcription from occurring so that proteins cannot be made.
C) The chemical prevents protein production because once made,the RNA cannot separate from its DNA template.
D) The chemical has no effect on protein production because mRNA contains uracil rather than thymine.

Question 26

What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation?

A) AGC
B) UGC
C) TGC
D) serine

Question 27

Each set of three bases in an mRNA molecule codes for one of 20 specific

A) rRNA molecules.
B) nucleotides.
C) amino acids.
D) proteins.

Question 28

Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation.In this analogy,what would best match the job of the ribosome?

A) the instructions
B) the person building the bookshelf
C) the pieces of wood
D) the bookshelf

Question 29

A mutation occurs in the promoter of a protein-encoding gene.How might this mutation affect the production of the protein encoded by the gene?

A) The mRNA made from this gene would exhibit the same mutation and therefore would not fold or function properly.
B) The protein made from the promoter would have a different amino acid sequence and therefore would not function properly.
C) The promoter might not be recognized by RNA polymerase,so the enzyme would be unable to attach to the promoter and start transcription.
D) The start codon would be missing from the mRNA made from this gene,so the mRNA could not be translated.

Question 30

Which of the following is a codon?

A) U
B) UU
C) UUG
D) UUGG

Question 31

Which of the following is NOT a feature of the genetic code?

A) Every individual has a different genetic code.
B) Each codon in the genetic code specifies only one amino acid.
C) The genetic code is redundant.
D) The same genetic code can be applied to virtually every organism on Earth.

Question 32

In the genetic code,an amino acid is specified by

A) a stop codon.
B) rRNA.
C) a series of four introns.
D) a sequence of three mRNA bases.

Question 33

During RNA splicing

A) introns are removed from RNA,and the remaining exons are connected to form a mature mRNA.
B) an RNA molecule is cut up into many small pieces and each piece forms a single mRNA.
C) exons are removed from RNA and the remaining introns are fused to form a single mRNA.
D) RNA is used to remove mutations from essential genes.

Question 34

The process depicted in the following figure takes place in

A) prokaryotic cells.
B) eukaryotic cells.
C) both prokaryotic and eukaryotic cells.
D) all cells involved in protein production.

Question 35

In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result

A) more RNA for aromatase is produced.
B) less RNA for aromatase is produced.
C) the production of aromatase is inhibited.
D) aromatase is degraded by other enzymes in the cell.

Question 36

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine

Question 37

Bacteria and humans use the same DNA components,and both kinds of cells also perform transcription and translation.Which of the following choices is a potentially significant outcome of this shared mechanism?

A) Bacteria are able to transcribe and translate human DNA;thus,they potentially could produce human proteins.
B) Bacteria are able to transcribe and translate human DNA;thus,they could evolve into humans.
C) Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same.
D) Bacterial and human DNA are identical in sequence because the method for producing them is the same.

Question 38

In bacteria,the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome.The most likely reason that bacteria die from treatment with tetracycline is because the antibiotic

A) inhibits the cell from producing the mRNA.
B) causes the tRNA molecules to randomly arrange into proteins that do not function.
C) causes tRNA rather than mRNA to be made into proteins.
D) prevents the bacteria from assembling essential proteins.

Question 39

Which of the following results would most likely occur if introns were not removed from newly made mRNA?

A) The introns along with the exons could be used to produce the proteins the cell needs.
B) The resulting protein would be longer than if the introns were removed.
C) The resulting DNA would not code for the correct gene.
D) The resulting rRNA would not code for the correct protein.

Question 40

During translation

A) many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein.
B) one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein.
C) strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein.
D) one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.

Question 41

Each tRNA molecule has a site at one end that ________ and a site at the other end that ________.

A) acts as a promoter;acts as a terminator
B) binds to a codon;binds to an anticodon
C) binds to an amino acid;binds to a promoter
D) binds to an amino acid;binds to a codon

Question 42

A potential danger of a mutation to an organism is that

A) it can affect codons within the spacer DNA.
B) all mutations are fatal.
C) it can cause a change in the function of a gene's protein product.
D) it can increase the length of the introns of that organism's genome.

Question 43

The following figure depicts a gene and two different ways that gene could be mutated.How does Mutation A differ from Mutation B?

A) Mutation A does not permanently change the sequence of the gene,but Mutation B does.
B) Mutation A involves the insertion of a base,whereas Mutation B involves the deletion of a base.
C) Mutation A results in a possible change in one amino acid in the protein produced by the gene,but Mutation B affects several amino acids.
D) Mutation A can only occur in introns,but Mutation B can occur in both introns and exons.

Question 44

The specific type of nucleic acid found in ribosomes,which are important in protein synthesis,is ________.

Question 45

The intermediary molecule that transmits information in a gene to a ribosome is ________.

Question 46

Which of the following is NOT a mechanism used by cells to reduce gene expression?

A) looser packing of DNA
B) a specific increase in mRNA breakdown
C) modification of proteins before their translation
D) stabilization of a protein so that its "shelf-life" is increased

Question 47

The chemical structure of bisphenol A (BPA)resembles

A) testosterone.
B) insulin.
C) estrogen.
D) progesterone.

Question 48

The lac repressor stops the expression of the genes in the lac operon.It does this by binding to a gene regulatory DNA sequence that controls the expression of the genes responsible for lactose uptake and degradation.This DNA sequence is called a(n)

A) operator.
B) operon.
C) repressicon.
D) inhibiron.

Question 49

The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

A) The repressor will be unable to bind to the operator,and the operon will thus be turned on.
B) The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose.
C) The lac operon will be degraded by the altered repressor.
D) The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there.

Question 50

A gene affects an organism's phenotype by controlling

A) protein production.
B) the mutation rate.
C) the organism's environment.
D) the organism's ribosomes.

Question 51

Translation,a process carried out by the ribosomes,occurs in the cell ________.

Question 52

The genes that control lactose utilization (its uptake and degradation)in bacteria are arranged sequentially in the bacterial chromosome under the control of a single promoter sequence.This arrangement of genes is called a(n)

A) operator.
B) exelon.
C) operon.
D) promoton.

Question 53

If X is a base that is inserted into each of the following DNA sequences,on which of them is it most likely to have the greatest effect on the gene's protein product?

A) AATGATATCATCCGACGXA
B) AATGATATCATCCGXACGA
C) AATGATATXCATCCGACGA
D) AXATGATATCATCCGACGA

Question 54

A tRNA molecule produced in a laboratory has the anticodon for the amino acid serine,but carries the amino acid leucine.When it reaches the serine codon on a molecule of mRNA where translation is under way,what is the most likely outcome?

A) It will not bind with the codon on the mRNA molecule.
B) A potentially dysfunctional protein will result.
C) A proofreading enzyme will change leucine to serine.
D) Translation will stop.

Question 55

The lac repressor has been mutated so that its binding site for the operator has been altered to the extent that it is unable to bind to the operator.What is the likely effect of this mutation on the lac operon?

A) The repressor will be unable to bind to the operator;the operon will bind RNA polymerase and it will thus be turned on.
B) The repressor will bind to the operator despite the mutation,and will suppress transcription of the operon in the presence and absence of lactose.
C) The lac operon will be protected by the altered repressor.
D) The repressor will be unable to bind to the operator;therefore,the ability of RNA polymerase to bind there will be severely hampered.

Question 56

When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

A) insertion
B) deletion
C) frameshift
D) substitution

Question 57

It is possible for a mutation to occur and yet not alter the end product of translation if

A) the RNA polymerase skips over the mutated area.
B) the new codon encodes the same amino acid.
C) a deletion mutation removes the entire codon.
D) the mutation affects the active site of the protein product.

Question 58

Most molecules of RNA are ________-stranded.

Question 59

For a firefly to glow,the enzyme luciferase must catalyze a chemical reaction in the cells of the firefly.A scientist uses a chemical to induce a mutation in the luciferase gene in a strain of fireflies.Which of the following is true?

A) Even if the mutation changes the structure of the luciferase protein,it will still be able to perform the chemical reactions needed to make the firefly glow.
B) The ability of the firefly to glow may or may not be affected by the mutation.
C) The mutation will affect the structure of the mRNA made from the gene,but not the structure of the protein made from the gene.
D) Any mutation in a gene causes that gene to stop making functional proteins.

Question 60

If a particular segment of DNA has the base sequence TAC,what will be the base sequence of the anticodon of the tRNA that carries the amino acid encoded by that stretch of DNA?

A) TAC
B) UAC
C) ATG
D) GUC

Question 61

If a molecule of mRNA is a sentence,its bases are the letters and the codons are the ________.

Question 62

The base sequence of mRNA specifies the sequence of amino acids in a ________.

Question 63

The series of bases in mRNA that can specify a single amino acid is called a(n)________.

Question 64

The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.

Question 65

If a eukaryotic protein is to function properly,the initial mRNA carrying the code for its structure must be processed to remove its ________.Then,before translation occurs,the joining together of the remaining sequences of mRNA,the ________,must be accomplished.

Question 66

If both strands of the DNA of a gene underwent transcription and translation,they would produce the same mRNA and protein.

Question 67

Molecule B in the following image is RNA.

Question 68

Ribosomal RNA plays a role in the formation of the covalent bonds between amino acids during translation.

Question 69

DNA replication involves the copying of the entire chromosome;in contrast,just a small portion of a chromosome is copied in the process of ________.

Question 70

A codon can specify up to three different amino acids.

Question 71

A human-made chemical that is found in hard plastics,CDs,DVDs,shower curtains,and many other products,and that has been accused of having a variety of harmful effects like obesity and cancer is ________.

Question 72

Gene regulatory proteins that interact with signals from the environment,both internal and external cues,and also with regulatory DNA to promote or repress gene expression are called ________.

Question 73

Because they are so distantly related,the codons for serine in a black widow spider would probably be much different from the codons for serine in bluebirds.

Question 74

Each time transcription occurs,all the DNA in a cell is copied.

Question 75

A sequence of DNA to which RNA polymerase binds in order to begin transcription is called the ________.

Question 76

Some tRNAs can recognize more than one codon because the base at the third position of their anticodon can pair with any one of two or three different bases in the codon;this phenomenon is called ________.

Question 77

Each tRNA molecule can bind with up to three codons,but carries only one specific ________.

Question 78

An insertion or deletion mutation can cause a change in the reading of the mRNA codons;in essence,it scrambles the codons.Such a mutation results in a genetic ________.

Question 79

Proteins are produced directly from DNA,with no intermediate steps.

Question 80

For translation to begin,mRNA must first bind to a ________.