Deck 12: Gene Mutation

Question 1

A chemical or physical agent that causes mutations is called a

A) mutator.
B) tautomer.
C) teratomer.
D) mutagen.
E) collagen.

Answer 1

D

Question 2

A germline mutation passes from generation to generation because it occurs during the DNA replication before

A) mitosis.
B) meiosis.
C) fertilization.
D) puberty.
E) RNA replication.

Answer 2

B

Question 3

Mutations in the lamin A gene are responsible for very diverse disorders because

A)different tissues have different variants of the gene.
B)lamin A proteins affect how chromatin touches the nuclear membrane.
C)many different results occur.
D)every tissue type has lamin A.
E)they are only active under certain conditions.

Answer 3

B

Question 4

The first single-gene disorder for which the mechanism of mutation was understood was

A) cystic fibrosis.
B) Duchenne muscular dystrophy.
C) hemophilia.
D) sickle cell disease.
E) diabetes mellitus.

Question 5

A somatic mutation

A) occurs only in microbes.
B) affects a particular subset of cells.
C) affects all cells of an individual.
D) is expressed only in embryos.
E) affects sleep cycles.

Question 6

A mutation in a collagen gene is likely to affect the phenotype because

A) it is extremely rare.
B) during meiosis, the chromosome that bears the mutation is more likely to enter a gamete than the chromosome that carries the wild type allele.
C) collagen has a very precise three-dimensional structure, so nearly any disruption alters the overall conformation.
D) people who use cosmetics with collagen silence collagen genes.
E) there are many collagen genes.

Question 7

Spontaneous mutation occurs when

A) a DNA base is in a rare tautomeric form as the replication fork arrives, and a mismatched base is inserted.
B) a person smokes cigarettes or is exposed to a teratogen for many years.
C) the sugars and phosphates in the DNA double helix exchange places.
D) thymine temporarily becomes uracil.
E) a replication fork stalls.

Question 8

Sanjay and Indira have thalassemia minor.Their young daughters are dizygotic (fraternal)twins.Malonie has thalassemia minor like her parents,but Jewel has the more severe thalassemia major.The more serious case most likely arose because

A) Jewel inherited two wild type alleles from her carrier parents.
B) Jewel inherited a dominant form of the condition.
C) Jewel inherited two recessive mutant alleles in the beta globin gene that cause thalassemia.
D) Jewel also has sickle cell disease.
E) Malonie underwent a deletion in the beta globin gene.

Question 9

The chance that the average gene undergoes a spontaneous mutation is about 1 in

A) 100.
B) 1,000.
C) 10,000.
D) 100,000.
E) 1,000,000.

Question 10

___ gene(s)encode chains of the same collagen molecule.

A) One
B) Two
C) Three
D) Four
E) Ten

Question 11

The parents-to-be were shocked when an ultrasound scan done in the second trimester of the pregnancy showed a fetus with obviously broken leg bones and ribs.The doctor diagnosed osteogenesis imperfecta.This is caused by a mutation in a gene that encodes

A) beta globin.
B) alpha globin.
C) a clotting factor.
D) myosin.
E) collagen.

Question 12

In Ehlers-Danlos syndrome type 1,collagen molecules are

A) too short.
B) missing.
C) too long.
D) too scarce.
E) too abundant.

Question 13

An example of a beneficial mutation is

A) a mutation in collagen that causes the skin to be extra stretchy.
B) the mutation that causes sickle cell disease.
C) a mutation in the CCR5 gene.
D) a mutation in a cytokine gene that causes an allergy.
E) a mutation that causes a person to be neither right nor left-handed.

Question 14

A man and woman of normal height have a son with achondroplasia.They want to have another child,and wonder what the risk is that he or she will also have this form of dwarfism.The risk is

A) 0 percent.
B) the same as for any other child in the population.
C) 25 percent.
D) 50 percent.
E) 50 percent for a boy and 25 percent for a girl.

Question 15

Estimates of spontaneous mutation rates are made using dominant disorders because

A) it takes several generations for the phenotype to change.
B) they do not affect offspring.
C) the mutant phenotype is obvious.
D) they can be identified by DNA sequencing.
E) they are much more common than recessive disorders.

Question 16

A mutation is

A) a change in a DNA sequence that affects at least 10 percent of individuals in a population.
B) a change in a DNA sequence present in less than 1 percent of individuals in a population.
C) a change in a DNA sequence that harms health.
D) a type of radiation that can alter the genetic code.
E) a substitution of amino acids for nucleotides in the genome.

Question 17

Mutations and polymorphisms are both changes in a DNA sequence,but polymorphisms are more common because

A) they less severely affect the phenotype, so that individuals can reproduce and transmit them.
B) more people have them.
C) mutations are always lethal.
D) they more severely affect the phenotype, so that individuals cannot reproduce and transmit them.
E) mutations refer to a real situation, whereas a polymorphism is an idealized state that biologists hypothesized to explain genetic change.

Question 18

The mutation that causes sickle cell disease

A) occurs in the same gene that, when mutant in a different way, causes beta thalassemia.
B) deletes two contiguous DNA bases.
C) results in a single DNA base change that does not alter the encoded amino acid.
D) changes a valine to a glutamic acid in the beta globin gene.
E) changes a glutamic acid to a valine in the alpha globin gene.

Question 19

A tautomer is

A) a mutagen.
B) an RNA base.
C) an alternate structure of a molecule.
D) a poison.
E) the type of bond that holds DNA bases together.

Question 20

In Huntington disease,the mutation causes the encoded protein to have a novel function from the wild type protein.This is an example of

A) a gain of function.
B) a loss of function.
C) a translocation of function.
D) a deletion.
E) a change in the genetic code.

Question 21

Which of the following is a transversion?

A) A to T
B) G to A
C) C to T
D) T to C
E) A to U

Question 22

A researcher might use site-directed mutagenesis because

A) spontaneous mutations occur too frequently to study.
B) using a mutagen yields results that are specific to a gene and not applicable everywhere in the genome.
C) mutation can happen at a specific site in the genome, compared to a mutagen that might cause mutations in several genes.
D) it works in humans but not in experimental organisms or cell culture.
E) it can treat genetic disease.

Question 23

The Hutterites are a peace-loving people descended from people who lived in the Austrian province of Tyrol in the 16th century,and immigrated to Montana and the Dakotas,then to Canada.Bowen-Conradi syndrome is a rare autosomal condition seen only among Hutterites,who marry within their own communities.The condition causes extreme growth retardation shortly before and after birth,resulting in early childhood death.The mutation that causes Bowen-Conradi syndrome changes an aspartic acid to a glycine by replacing an A with a G.This is a _______ mutation affecting the _____ codon position.(Consult the genetic code in figure 10.12 for your answer).

A)missense; first
B)missense; third
C)missense; second
D)nonsense; second
E)nonsense; third

Question 24

Which addition to a DNA sequence would not cause a frameshift mutation?

A) T
B) GC
C) GCT
D) GGCT
E) AAAAA

Question 25

A source of gamma radiation is

A) plutonium and cesium isotopes.
B) alpha and beta globin.
C) uranium and radium.
D) carbon-14 and strontium-70.
E) kryptonite and dilithium crystals.

Question 26

Which type of mutation substitutes one amino acid for another?

A) nonsense
B) missense
C) sense
D) presence
E) antisense

Question 27

The phenotype of a person with alpha thalassemia depends on

A) the number of beta globin genes.
B) the presence or absence of a sickle cell mutation.
C) the number of alpha globin chains.
D) the rate of replication of the alpha globin genes.
E) whether the person smokes or not.

Question 28

A point mutation alters

A) a single base.
B) 3 bases.
C) a chromosome tip.
D) a centromere.
E) only a purine.

Question 29

Mutations are more likely to occur in or near repeated DNA sequences because

A) these bases are unstable.
B) bases in the strand can form base pairs, generating loops that interfere with replication and repair enzymes.
C) the repeats hold onto the replication enzymes, causing base mismatches.
D) the repeats attract and bind to mutagens, increasing the mutation rate.
E) repeated sequences do not have a sugar-phosphate backbone.

Question 30

Direct repeats can cause mutation when

A) a person encounters a mutagen.
B) homologs misalign during meiosis such that the first copy of the gene on one chromosome lies opposite the second copy on the homolog.
C) introns are not removed promptly and their sequences are included in the gene product.
D) they bond within the same DNA strand, forming loops that disrupt replication enzymes.
E) they jump out of the chromosome and spontaneously invert.

Question 31

Acridine dyes are mutagens that

A) disrupt the reading frame of the gene.
B) replace an AT base pair with a GC base pair.
C) reverse the polarity of the double helix.
D) kill cells.
E) change a deoxyribose to a ribose.

Question 32

Four children of a man and woman who are second cousins have too few teeth,an autosomal recessive condition called oligodontia caused by mutation in a gene called LTPB3 on chromosome 11.The affected individuals are also short with increased bone density in the spine and skull.The protein that causes the symptoms by affecting certain bone cells is too short.The mutation in this family is most likely

A) a missense mutation.
B) a nonsense mutation.
C) a deletion of 9 bases.
D) a duplication of the gene.
E) a replacement of all purines with pyrimidines.

Question 33

Ionizing radiation alters DNA by

A) deleting bases.
B) removing the nitrogen from the bases.
C) kinking the double helix.
D) breaking the sugar-phosphate backbone.
E) reversing replication forks.

Question 34

A sign that mutation occurred in a person exposed to radiation in the aftermath of the Chernobyl disaster of 1986 was

A) acute radiation sickness in the exposed person.
B) short DNA repeats in a child's genome that didn't match the size in either exposed parent.
C) increased rates of asthma and allergies in the exposed people and their children.
D) a child that failed an Ames test.
E) loss of teeth in exposed individuals.

Question 35

Mutational hot spots occur most often where the DNA is

A) unwound and stretched.
B) repetitive or symmetrical.
C) highly coiled.
D) bound by RNA polymerase.
E) replaced with RNA in the genome.

Question 36

A mutation that changes the third position in a CUU codon to a C would

A) profoundly change the protein's conformation.
B) result in a frameshift mutation.
C) shorten the protein.
D) have no effect on the protein.
E) also change the first two positions.

Question 37

A mutation that changes the codon GAA to UAA is a _______ mutation.

A) missense
B) nonsense
C) frameshift
D) truncation
E) viral

Question 38

Which of the following is a transition mutation?

A) ACC to CCC
B) A to G
C) GG to AA
D) A to T
E) a deoxyribonucleotide to a ribonucleotide

Question 39

Fragile X syndrome is caused by a(n)

A) deletion.
B) translocation.
C) expanding triplet repeat.
D) point mutation.
E) brittle nucleotides.

Question 40

Palindrome sequences are often found at mutation hotspots.Which of the following is a palindrome?

A) AAAATTTT
B) ATATGCGC
C) GATCCTAG
D) GATCGATC
E) UCGUGGCCUU

Question 41

Synonymous codons protect against mutation because

A) the encoded amino acid changes to a smaller one.
B) the encoded amino acid changes to a larger one.
C) the encoded amino acid does not change.
D) they are not nonsynonymous.
E) they cause dangerous mutations to be excised and repaired.

Question 42

The fact that myotonic dystrophy worsens with each generation is due to

A) a second somatic point mutation.
B) an increasing number of repeated short DNA sequences.
C) a transposing tandem triplet repeat.
D) family members perceiving their symptoms as worse.
E) genetic anticipation.

Question 43

________ can usually repair DNA damage caused by ultraviolet light.

A) DNA ligase
B) Photoreactivation
C) Ionizing radiation
D) DNA replication
E) Chromatin remodeling

Question 44

Missense mutations cause large deletions when they

A) alter a protein's shape and affect its function.
B) alter an intron splicing site so that an entire exon is deleted.
C) change a triplet codon that does not affect the reading frame.
D) invert a segment of a chromosome.
E) create a stop signal.

Question 45

A missense mutation causes sickle cell disease by

A) altering the protein's shape and affecting its function.
B) changing a triplet codon that does not affect the reading frame.
C) altering an intron splicing site so that an entire exon is deleted.
D) substituting beta globin chains with alpha globin chains.
E) deleting the gene for a key clotting factor.

Question 46

The type of DNA repair that corrects errors due to oxidative damage by replacing one to five nucleotides is

A) mismatch repair.
B) base excision repair.
C) roto-rooter repair.
D) photoreactivation.
E) repair of the sugar-phosphate backbone.

Question 47

In a form of early-onset Alzheimer disease caused by a mutation on chromosome 14,A is changed to T at the first position of codon 146,which substitutes leucine for methionine.This mutation is a _______ and is __________.

A) transversion; nonsense
B) transversion; missense
C) transition; missense
D) transition; nonsense
E) transcondition; antisense

Question 48

Which of the following disorders does not involve faulty DNA repair?

A) xeroderma pigmentosum
B) trichothiodystrophy
C) ataxia telangiectasis
D) Becker muscular dystrophy
E) hereditary nonpolyposis colon cancer

Question 49

Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?

A) GTCCCA
B) GTCCTGATTATTCA
C) GTCCACTTATT
D) GTCCTTATATTCA
E) GTCCTTATTCAACTTATTCCTG

Question 50

Transposable elements

A) are found only in viruses.
B) cannot mutate.
C) move.
D) are rare.
E) are deleted in meiosis.

Question 51

A mutation is more likely to affect a differentiated cell than a stem cell due to

A) skewed distribution of parental versus newly replicated DNA.
B) a conscious effort on the part of the individual.
C) lack of DNA replication in stem cells.
D) skewed distribution of stem and progenitor cells.
E) repair enzymes in stem cells that are not in differentiated cells.

Question 52

A nonfunctional gene near a similar but functional gene is called a(n)

A) pseudogene.
B) expanded gene.
C) phenocopy.
D) transposon.
E) psychogene.

Question 53

A mutation expressed only under certain conditions is

A) germinal.
B) somatic
C) de novo.
D) conditional.
E) deleterious

Question 54

Ultraviolet light damages DNA by causing

A) purine rings.
B) strand breaks.
C) pyrimidine dimers.
D) radioactivity.
E) night blindness.

Question 55

Homozygotes for hemoglobin C have

A) sickle cell disease.
B) a normal phenotype.
C) a bluish complexion.
D) a black mouth.
E) black ear tips.

Question 56

Protection against inherited prion disorders seems to depend upon

A)whether people are heterozygotes at particular part of the prion protein gene.
B)whether people have extra copies of the prion protein gene.
C)whether people eat food contaminated with toxin from E.coli.
D)whether people eat tainted beef.
E)whether people inherit a sickle cell allele.

Question 57

Copy number variants

A) are extremely are, occurring in only about a dozen sites in the genome.
B) are found only in even-numbered chromosomes.
C) account for about 25 percent of the genome and number in the hundreds to thousands.
D) account for less than 1 percent of the genome and are five or fewer bases long.
E) are very common in the genomes of fetuses and infants but are lost as we age.

Question 58

Individuals with _______ develop numerous skin cancers when exposed to sunlight.

A) ataxia telangiectasis
B) Cockayne syndrome
C) Werner syndrome
D) xeroderma pigmentosum
E) hereditary nonpolyposis colon cancer