
Genetics: Analysis and Principles 5th Edition by Robert Brooker
النسخة 5الرقم المعياري الدولي: 978-0073525341
Genetics: Analysis and Principles 5th Edition by Robert Brooker
النسخة 5الرقم المعياري الدولي: 978-0073525341 تمرين 6
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription An RNA transcript has the following sequence:
5 GGCAUGCAUUACGGCAUCACACUAGGGAUC 3
What is the sequence of the template and coding strands of the DNA that encodes this RNA On which side (5 or 3 ) of the template strand is the promoter located
5 GGCAUGCAUUACGGCAUCACACUAGGGAUC 3
What is the sequence of the template and coding strands of the DNA that encodes this RNA On which side (5 or 3 ) of the template strand is the promoter located
التوضيح
The rule of complementarity that is need...
Genetics: Analysis and Principles 5th Edition by Robert Brooker
لماذا لم يعجبك هذا التمرين؟
أخرى 8 أحرف كحد أدنى و 255 حرفاً كحد أقصى
حرف 255

