expand icon
book Biology 8th Edition by Kenneth Mason ,Jonathan Losos,Susan Singer,Peter Raven,George Johnson cover

Biology 8th Edition by Kenneth Mason ,Jonathan Losos,Susan Singer,Peter Raven,George Johnson

النسخة 8الرقم المعياري الدولي: 978-0077536848
book Biology 8th Edition by Kenneth Mason ,Jonathan Losos,Susan Singer,Peter Raven,George Johnson cover

Biology 8th Edition by Kenneth Mason ,Jonathan Losos,Susan Singer,Peter Raven,George Johnson

النسخة 8الرقم المعياري الدولي: 978-0077536848
تمرين 12
A template strand of DNA has the following sequence:
3' - CGTTACCCGAGCCGTACGATTAGG - 5'
Use the sequence information to determine
a. the predicted sequence of the mRNA for this gene.
b. the predicted amino acid sequence of the protein.
التوضيح
موثّق
like image
like image

(a) Template strand is used to produce m...

close menu
Biology 8th Edition by Kenneth Mason ,Jonathan Losos,Susan Singer,Peter Raven,George Johnson
cross icon