expand icon
book Molecular Biology of the Gene 7th Edition by Richard Losick, James Watson, Michael Levine, Tamara Baker, Alexander Gann cover

Molecular Biology of the Gene 7th Edition by Richard Losick, James Watson, Michael Levine, Tamara Baker, Alexander Gann

النسخة 7الرقم المعياري الدولي: 9780321762436
book Molecular Biology of the Gene 7th Edition by Richard Losick, James Watson, Michael Levine, Tamara Baker, Alexander Gann cover

Molecular Biology of the Gene 7th Edition by Richard Losick, James Watson, Michael Levine, Tamara Baker, Alexander Gann

النسخة 7الرقم المعياري الدولي: 9780321762436
تمرين 13
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region.
5?... GCT AAGTATTGCTCAAGATTAGGATGATAAATAACTGG3?
3?... CGA TTCATAACGAGTTCTAATCCTACTATTTATTGACC5?
A. Which strand is the template strand for transcription of this gene? Briefly explain how you know.
B. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur?
C. A change of one base pair leads to the protein increasing in length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair to for the protein to increase in length by one amino acid?
التوضيح
موثّق
like image
like image

The given sequence is a double stranded ...

close menu
Molecular Biology of the Gene 7th Edition by Richard Losick, James Watson, Michael Levine, Tamara Baker, Alexander Gann
cross icon