expand icon
book Genetics - Analysis and Principles 3rd Edition by Robert Brooker cover

Genetics - Analysis and Principles 3rd Edition by Robert Brooker

النسخة 3الرقم المعياري الدولي: 978-0071287647
book Genetics - Analysis and Principles 3rd Edition by Robert Brooker cover

Genetics - Analysis and Principles 3rd Edition by Robert Brooker

النسخة 3الرقم المعياري الدولي: 978-0071287647
تمرين 12
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription An RNA transcript has the following sequence:
5 GGCAUGCAUUACGGCAUCACACUAGGGAUC 3
What is the sequence of the template and coding strands of the DNA that encodes this RNA On which side (5 or 3 ) of the template strand is the promoter located
التوضيح
موثّق
like image
like image

The rule of complementarity that is need...

close menu
Genetics - Analysis and Principles 3rd Edition by Robert Brooker
cross icon