تكلم مع الذكاء الاصطناعي
The Living World 6th Edition by George Johnson, Jonathan Losos,William Ober,Claire Garrison
النسخة 6الرقم المعياري الدولي: 978-0077280086The Living World 6th Edition by George Johnson, Jonathan Losos,William Ober,Claire Garrison
النسخة 6الرقم المعياري الدولي: 978-0077280086 تمرين 3
The nucleotide sequence of a hypothetical gene is: TACATACTTAGTTACGTCGCCCGGAAATAT
a. What will be the sequence on the mRNA when it is transcribed
b. What will be the amino acid sequence of the protein when it's translated
c. What would happen to the amino acid chain if the highlighted nucleotide underwent a mutation and was changed to an adenine
a. What will be the sequence on the mRNA when it is transcribed
b. What will be the amino acid sequence of the protein when it's translated
c. What would happen to the amino acid chain if the highlighted nucleotide underwent a mutation and was changed to an adenine
التوضيح
موثّق
موثّق
The given nucleotide sequence of a hypot...
The Living World 6th Edition by George Johnson, Jonathan Losos,William Ober,Claire Garrison
لماذا لم يعجبك هذا التمرين؟
أخرى 8 أحرف كحد أدنى و 255 حرفاً كحد أقصى
حرف 255
