Deck 26: Developmental Genetics

Question 1

Discuss the two principles on which evolution is based.

Answer 1

The theory of evolution, as formulated by Darwin, is broadly based on two important principles both working at the species level and genetic level. The two important principles are: (i) genetic variation and (ii) natural selection.
Genetic variation :
This refers to the differences in the alleles of a gene that result in variations both within populations and among populations. At the species level, genetic variation is evident in the form of variation in phenotypes. For example Darwin observed that children resemble parents' more than unrelated people.
At the genetic level, as we know, genetic variation involves differences in the alleles of a gene that can be caused by mutations. These mutations result in changes in the phenotypes that cause variations at the species level.
Natural Selection :
The concept of natural selection has its core centered on the theory of "survival of the fittest." According to this theory, only those species tend to dominate populations, who have the most favorable set of traits that allow them to survive the extreme and adverse conditions in an environment.
Thus, this concept at the species level, results in either an increase or decrease in certain traits resulting in the emergence and survival of those phenotypes and genotypes, that help the population to survive the best.
At the genetic level, those alleles that prove to be beneficial are inherited while those that are not useful or detrimental are not inherited ultimately leading to their elimination. This results in changes in the allele frequencies of a genE.

Question 2

Two populations of snakes are separated by a river. The snakes cross the river only on rare occasions. The snakes in the two populations look very similar to each other, except that the members of the population on the eastern bank of the river have a yellow spot on the top of their head, whereas the members of the western population have an orange spot on the top of their head. Discuss two experimental methods that you might follow to determine whether the two populations are members of the same species or members of different ones.

Answer 2

Since the populations of the snakes are separated by a physical barrier, thus there might be a possibility of reproductive isolation amongst them. Thus, some of the best ways to determine, if the two species of snakes are members of the same or different species, are:
• Watching the two populations of snakes in nature, by sitting in a hidden spot, and observing if the eastern and western snakes interbreed in their natural environment.
• The next step could be to breed them in captivity and observe if they mate with each other in captivity.
• The best method of all would be to read and assess the chromosome structure and number for any differences present if any by karyotyping.

Question 3

The raw material for evolution is random mutation. Discuss whether or not you view evolution as a random process.

Answer 3

Evolution as a process has two stages:
• The first stage is the stage of random mutations. In this stage, the population of a species might undergo various types of mutations depending upon the type of speciation or isolation that has acted upon it. For example, if a population of birds gets isolated by geographical barrier into four populations, then each population would develop random mutations depending on the environment conditions in their respective areas. Thus, the first step of evolution is a random process.
• The second step of evolution is natural selection. In this stage, the nature plays its role in selecting the fittest of the lot. So in the above given example, of the four population of birds that have undergone random mutations, the nature will now select the ones that have the most beneficial mutations. So, the ones that have the least beneficial mutations or detrimental ones would be eliminated. Hence here, there is no role of randomness. Instead, it occurs slowly and in a manner that can explained for. Hence, this process of natural selection is not random.
Thus, though the process of evolution includes random mutations, the evolution itself is not a random process as a whole.

Question 4

Evolution, which involves genetic changes in a population of organisms over time, is often described as the unifying theme in biology. Discuss how evolution is unifying at the molecular and cellular levels.

Question 5

Sympatric speciation by allotetraploidy has been proposed as a common mechanism for speciation. Let's suppose you were interested in the origin of certain grass species in southern California. Experimentally, how would you go about determining if some of the grass species are the result of allotetraploidy

Question 6

Compare the forms of speciation that are slow with those that occur more rapidly. Make a list of the slow and fast forms. With regard to mechanisms of genetic change, what features do slow and rapid speciation have in common What features are different

Question 7

Reproductive isolation is the inability of a species to breed
successfully with related species. This is caused due to
geographical, behavioral, physiological, or genetic barriers.
Ernst Mayor has classified the mechanism of reproductive
isolation into two broad categories as isolation before
fertilization (pre-zygotic) and isolation after fertilization
(post-zygotic).

Question 8

Two diploid species of closely related frogs, which we will call species A and species B, were analyzed with regard to genes that encode an enzyme called hexokinase. Species A has two distinct copies of this gene: A1 and A 2. In other words, this diploid species is A1A1 A 2 A 2. The other species has three copies of the hexokinase gene, which we will call B1 , B2, and B3. A diploid individual of species B would be B1B1 B2B2 B3B3. These hexokinase genes from the two species were subjected to DNA sequencing, and the percentage of sequence identity was compared among these genes. The results are shown here.
Percentage of DNA Sequence Identity

If we assume that hexokinase genes were never lost in the evolution of these frog species, how many distinct hexokinase genes do you think there were in the most recent ancestor that preceded the divergence of these two species Explain your answer. Also explain why species B has three distinct copies of this gene, whereas species A has only two.

Question 9

Do you think that Darwin would object to the neutral theory of evolution

Question 10

Briefly describe four different species concepts.

Question 11

A researcher sequenced a portion of a bacterial gene and obtained the following sequence, beginning with the start codon, which is underlined:
ATG CCG GAT TAC CCG GTC CCA AAC AAA ATG ATC GGC CGC CGA ATC TAT CCC
The bacterial strain that contained this gene has been maintained in the laboratory and grown serially for many generations.
Recently, another person working in the laboratory isolated DNA from the bacterial strain and sequenced the same region. The following results were obtained:
ATG CCG GAT TAT CCG GTC CCA AAT AAA ATG ATC GGC CGC CGA ATC TAC CCC
Explain why these sequencing differences may have occurred.

Question 12

Would the following examples of reproductive isolation be considered a prezygotic or postzygotic mechanism
A. Horses and donkeys can interbreed to produce mules, but the mules are infertile.
B. Three species of the orchid genus Dendrobium produce flowers 8 days, 9 days, and 11 days after a rainstorm. The flowers remain open for 1 day.
C. Two species of fish release sperm and eggs into seawater at the same time, but the sperm of one species do not fertilize the eggs of the other species.
D. Two tree frogs, Hyla chrysoscelis (diploid) and H. versicolor (tetraploid), can produce viable offspring, but the offspring are sterile.

Question 13

F 1 hybrids between two species of cotton, Gossypium barbadense and G. hirsutum , are very vigorous plants. However, F 1 crosses produce many seeds that do not germinate and a high percentage of very weak F 2 offspring. Suggest two reasons for these observations.

Question 14

Distinguish between anagenesis and cladogenesis. Which type of speciation is more prevalent Why

Question 15

A species of antelope contains 20 chromosomes per set. The species is divided by a mountain range into two separate populations, which we will call the eastern and western population. When comparing the karyotypes of these two populations, it was discovered that the members of the eastern population are homozygous for a large inversion within chromosome 14. How would this inversion affect the interbreeding between the two populations Could such an inversion play an important role in speciation

Question 16

Describe three or more genetic mechanisms that may lead to the rapid evolution of a new species. Which of these genetic mechanisms are influenced by natural selection, and which are not

Question 17

Explain why molecular techniques were needed as a way to provide evidence for the neutral theory of evolution.

Question 18

Explain the type of speciation (allopatric, parapatric, or sympatric) most likely to occur under each of the following conditions:
A. A pregnant female rat is transported by an ocean liner to a new continent.
B. A meadow containing several species of grasses is exposed to a pesticide that promotes nondisjunction.
C. In a very large lake containing several species of fish, the water level gradually falls over the course of several years. Eventually, the large lake becomes subdivided into smaller lakes, some of which are connected by narrow streams.

Question 19

Prehistoric specimens often contain minute amounts of ancient DNA. What technique can be used to increase the amount of DNA in an older sample Explain how this technique is performed and how it increases the amount of a specific region of DNA.

Question 20

Alloploids are produced by crosses involving two different species. Explain why alloploids may be reproductively isolated from the two original species from which they were derived. Explain why alloploids are usually sterile, whereas allotetraploids (containing a diploid set from each species) are commonly fertile.

Question 21

In the experiment of Figure 28.13, explain how we know that the kiwis are more closely related to the emu and cassowary than to the moas. Cite particular regions in the sequences that support your answer.
FIGURE 28.13 DNA analysis of orthologs reveals phylogenetic relationships among extinct and modern flightless birds.

Question 22

Discuss the evidence in favor of the punctuated equilibrium model of evolution. What mechanisms could account for this pattern of evolution In contrast, what type of genetic changes are consistent with gradualism

Question 23

In Chapter 22, we learned about a technique called fluorescence in situ hybridization (FISH), during which a labeled piece of DNA is hybridized to a set of chromosomes. Let's suppose that we cloned a piece of DNA from G. pubescens (see Figure 28.4) and used it as a labeled probe for in situ hybridization. What would you expect to happen if we hybridized it to the G. speciosa or G. tetrahit chromosomes Describe your expected results.
FIGURE 28.4 A comparison of crosses between three natural species of hemp nettle with different ploidy levels. (a) Galeopsis tetrahit is an allotetraploid that is thought to be derived from Galeopsis pubescens and Galeopsis speciosa. (b) If G. tetrahit is crossed with the other two species, the F 1 hybrid offspring will be monoploid for one chromosome set and diploid for the other. The F 1 offspring are likely to be sterile, because they will produce highly aneuploid gametes.

Question 24

Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species

Question 25

A team of researchers has obtained a dinosaur bone ( Tyrannosaurus rex ) and has attempted to extract ancient DNA from it. Using primers to the 12S rRNA mitochondrial gene, they have used PCR and obtained a DNA segment that yields a sequence homologous to crocodile DNA. Other scientists are skeptical that this sequence is really from the dinosaur. Instead, they believe that it may be due to contamination from more recent DNA, such as the remains of a reptile that lived much more recently. What criteria might you use to establish the credibility of the dinosaur sequence

Question 26

Discuss the major differences among allopatric, parapatric, and sympatric speciation.

Question 27

Discuss how the principle of parsimony can be used in a cladistics approach of constructing a phylogenetic tree.

Question 28

The following are two DNA sequences from homologous genes:
TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA
GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT
The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Question 29

As discussed in this chapter and Chapter 26, genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might give misleading results when constructing a phylogenetic tree. How could you overcome this problem

Question 30

What is meant by the term molecular clock How is this concept related to the neutral theory of evolution

Question 31

If a researcher used genetic engineering techniques to express the Drosophila eyeless gene in the embryo at the region that will become the tip of the mouse's tail, what results would you expect in the resulting offspring

Question 32

Would the rate of deleterious or beneficial mutations be a good molecular clock Why or why not

Question 33

Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene Explain your answer.

Question 34

When comparing the coding region of structural genes among closely related species, it is commonly found that certain regions of the gene have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions of the gene. Explain why different regions of a structural gene evolve at different rates.

Question 35

Plant seeds contain storage proteins that are encoded by plant genes. When the seed germinates, these proteins are rapidly hydrolyzed (i.e., the covalent bonds between amino acids within the polypeptides are broken), which releases amino acids for the developing seedling. Would you expect the genes that encode plant storage proteins to evolve more slowly or more rapidly than genes that encode enzymes Explain your answer.

Question 36

Figure 26.9 shows a phylogenetic tree of all life on Earth based on 16S rRNA data. Based on your understanding of molecular genetics (in this and other chapters), describe three or more observations that suggest that all life-forms on Earth evolved from a common ancestor or group of ancestors.

Question 37

Take a look at the -globin and -globin sequences in Figure 28.11. Which sequences are more similar, the globin in humans and the globin in horses, or the globin in humans and the globin in humans Based on your answer, would you conclude that the gene duplication that gave rise to the -globin and -globin genes occurred before or after the divergence of humans and horses Explain your reasoning.
FIGURE 28.11 A comparison of the - and -globin polypeptides from humans and horses. (a) An alignment of the deduced amino acid sequences obtained by sequencing the exon portions of the corresponding genes. The gaps indicate where additional amino acids are found in the sequence of myoglobin, another member of this gene family. (b) A comparison of amino acid differences between orthologs and paralogs.

Question 38

Compare and contrast the neutral theory of evolution versus the Darwinian (i.e., selectionist) theory of evolution. Explain why the neutral theory of evolution is sometimes called non-Darwinian evolution.

Question 39

For each of the following examples, discuss whether it would be the result of neutral mutations or mutations that have been acted on by natural selection, or both:
A. When comparing sequences of homologous genes, differences in the coding sequence are most common at the wobble base (i.e., the third base in each codon).
B. For a protein-encoding gene, the regions that encode portions of the polypeptide that are vital for structure and function are less likely to display mutations than other regions of the gene.
C. When comparing the sequences of homologous genes, introns usually have more sequence differences than exons.

Question 40

As discussed in Chapter 26, genetic variation is prevalent in natural populations. This variation is revealed in the DNA sequencing of genes. According to the neutral theory of evolution, discuss the relative importance of natural selection against detrimental mutations, natural selection in favor of beneficial mutations, and neutral mutations in accounting for the genetic variation we see in natural populations.

Question 41

If you were comparing the karyotypes of species that are closely related evolutionarily, what types of similarities and differences would you expect to find

Question 42

In the developing bud that gives rise to a hand in a human embryo, where would you expect the gremlin gene to be expressed

Question 43

Discuss how Hox gene number is related to body complexity.