Deck 12: From Gene to Protein

Full screen (f)
exit full mode
Question
As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

A) promoter.
B) intron.
C) start codon.
D) anticodon.
Use Space or
up arrow
down arrow
to flip the card.
Question
Which of the following is true of rRNA?

A) It is made up of base pairs.
B) It carries amino acids.
C) It is not translated.
D) It helps transcribe DNA.
Question
Which of the following would be found only in RNA?

A) deoxyribose and uracil
B) ribose and thymine
C) ribose and uracil
D) deoxyribose and thymine
Question
Which of the following is true of transcription?

A) It destroys the DNA template.
B) The DNA molecule must unwind.
C) Base pairing is unimportant.
D) The end result is a protein.
Question
The sugar molecule present in RNA is

A) uracil.
B) deoxyribose.
C) ribose.
D) sucrose.
Question
Protein coding genes specify the manufacture of ________ as their immediate product.

A) rRNA
B) tRNA
C) DNA
D) mRNA
Question
Following transcription,the

A) strands of DNA bond back to each other.
B) mRNA is digested.
C) DNA molecule is broken down.
D) ribosome is released from the tRNA molecule.
Question
DNA molecules are double-stranded,whereas most RNA molecules are single-stranded.Which of the following choices is the most likely reason that RNA does NOT need to be double-stranded?

A) DNA reproduces itself directly, whereas RNA does not.
B) RNA reproduces itself directly, whereas DNA does not.
C) DNA undergoes translation that requires the use of both strands at the same time.
D) RNA undergoes transcription that can only read one strand at a time.
Question
The sequence of nucleotides in an mRNA molecule

A) is complementary to the DNA template strand.
B) matches the sequence of the ribosome that will translate the mRNA.
C) exactly matches the template strand (except where U is substituted for T).
D) is identical to that of the promoter.
Question
Which of the following is the best and most complete description of the function of genes?

A) They control the production of enzymes.
B) They control the production of structural proteins.
C) They control the production of all proteins.
D) They control the production of amino acids.
Question
Which of the following does NOT take place in the nucleus?

A) transcription
B) RNA splicing
C) replication
D) translation
Question
During transcription

A) the DNA strands replicate, producing four mRNA molecules.
B) each strand in the DNA molecule directs the production of an mRNA molecule.
C) a template strand of DNA directs the production of an mRNA molecule.
D) a template strand of DNA directs only the production of all the tRNA molecules needed for producing the gene's protein product.
Question
The information in a gene is encoded by the

A) introns of eukaryotic cells.
B) amino acids that make up the genes.
C) base sequences of the gene's DNA.
D) rRNA that transfers amino acids to ribosomes.
Question
The key enzyme used during transcription is

A) RNA polymerase.
B) DNA polymerase.
C) rRNA.
D) terminase.
Question
The order of the bases in DNA determines the order of the

A) amino acids in DNA.
B) bases in a protein.
C) amino acids in mRNA.
D) bases in mRNA.
Question
A promoter would be located on

A) the template strand of a DNA molecule.
B) the anticodon of a tRNA molecule.
C) an mRNA molecule.
D) RNA polymerase.
Question
If a strand of DNA has the sequence CGTAA,the mRNA made from this molecule will have the sequence

A) CGTAA.
B) GCUTT.
C) TAGCC.
D) GCAUU.
Question
The bases present in an RNA molecule are

A) C, T, A, and G.
B) U, A, C, and G.
C) G, C ,U, and T.
D) U, C, T, and A.
Question
Prokaryotes lack membrane-bound organelles and thus do not have nuclei; therefore

A) prokaryotes are unable to undergo transcription and translation.
B) prokaryotic cells do not need to undergo translation.
C) prokaryotic transcription and translation both take place in the cytoplasm.
D) prokaryotes are unable to replicate their DNA.
Question
How does a molecule of RNA polymerase "know" which of the two strands of DNA it should use as a template strand?

A) RNA polymerase recognizes the start codon.
B) RNA polymerase binds to the promoter in a specific orientation that determines which DNA strand it will be able to "read."
C) The ribosome binds to the promoter in a specific orientation that determines which DNA strand it will be able to "read."
D) RNA polymerase binds randomly to one strand or the other, so that roughly half of its attachments to DNA result in the production of the correct mRNA.
Question
Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? <strong>Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?  </strong> A) tyrosine-tyrosine-alanine B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine C) methionine-proline-glutamate D) methionine-proline-glutamate-isoleucine-alanine <div style=padding-top: 35px>

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Question
Which of the following is NOT a feature of the genetic code?

A) Every individual has a different genetic code.
B) Each codon in the genetic code specifies only one amino acid.
C) The genetic code is redundant.
D) The same genetic code can be applied to virtually every organism on Earth.
Question
The process depicted in the following figure takes place in <strong>The process depicted in the following figure takes place in  </strong> A) prokaryotic cells. B) eukaryotic cells. C) both prokaryotic and eukaryotic cells. D) all cells involved in protein production. <div style=padding-top: 35px>

A) prokaryotic cells.
B) eukaryotic cells.
C) both prokaryotic and eukaryotic cells.
D) all cells involved in protein production.
Question
Which molecules are involved in translation?

A) DNA and RNA
B) mDNA, tDNA, and rDNA
C) mRNA, tRNA, and rRNA
D) proteins, amino acids, and DNA
Question
What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation? <strong>What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation?  </strong> A) AGC B) UGC C) TGC D) serine <div style=padding-top: 35px>

A) AGC
B) UGC
C) TGC
D) serine
Question
Bacteria and humans use the same DNA components,and both kinds of cells also perform transcription and translation.Which of the following choices is a potentially significant outcome of this shared mechanism?

A) Bacteria are able to transcribe and translate human DNA; thus, they potentially could produce human proteins.
B) Bacteria are able to transcribe and translate human DNA; thus, they could evolve into humans.
C) Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same.
D) Bacterial and human DNA are identical in sequence because the method for producing them is the same.
Question
Each set of three bases in an mRNA molecule codes for one of 20 specific

A) rRNA molecules.
B) nucleotides.
C) amino acids.
D) proteins.
Question
Which of the lettered arrows in the following diagram of translation indicates a codon? <strong>Which of the lettered arrows in the following diagram of translation indicates a codon?  </strong> A) A B) B C) C D) D <div style=padding-top: 35px>

A) A
B) B
C) C
D) D
Question
Which of the following results would most likely occur if introns were not removed from newly made mRNA?

A) The introns along with the exons could be used to produce the proteins the cell needs.
B) The resulting protein would be longer than if the introns were removed.
C) The resulting DNA would not code for the correct gene.
D) The resulting rRNA would not code for the correct protein.
Question
In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result

A) more RNA for aromatase is produced.
B) less RNA for aromatase is produced.
C) the production of aromatase is inhibited.
D) aromatase is degraded by other enzymes in the cell.
Question
In the genetic code,an amino acid is specified by

A) a stop codon.
B) rRNA.
C) a series of four introns.
D) a sequence of three mRNA bases.
Question
Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG? <strong>Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG?  </strong> A) ACAUGCUAUAUCCCG B) ACATGCTATATCCCG C) cysteine-threonine-isoleucine-glycine D) cysteine-threonine-isoleucine-glycine-stop <div style=padding-top: 35px>

A) ACAUGCUAUAUCCCG
B) ACATGCTATATCCCG
C) cysteine-threonine-isoleucine-glycine
D) cysteine-threonine-isoleucine-glycine-stop
Question
During translation

A) many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein.
B) one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein.
C) strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein.
D) one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.
Question
Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation.In this analogy,what would best match the job of the ribosome?

A) the instructions
B) the person building the bookshelf
C) the pieces of wood
D) the bookshelf
Question
During RNA splicing

A) introns are removed from RNA, and the remaining exons are connected to form a mature mRNA.
B) an RNA molecule is cut up into many small pieces and each piece forms a single mRNA.
C) exons are removed from RNA and the remaining introns are fused to form a single mRNA.
D) RNA is used to remove mutations from essential genes.
Question
In bacteria,the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome.The most likely reason that bacteria die from treatment with tetracycline is because the antibiotic

A) inhibits the cell from producing the mRNA.
B) causes the tRNA molecules to randomly arrange into proteins that do not function.
C) causes tRNA rather than mRNA to be made into proteins.
D) prevents the bacteria from assembling essential proteins.
Question
A mutation occurs in the promoter of a protein-encoding gene.How might this mutation affect the production of the protein encoded by the gene?

A) The mRNA made from this gene would exhibit the same mutation and therefore would not fold or function properly.
B) The protein made from the promoter would have a different amino acid sequence and therefore would not function properly.
C) The promoter might not be recognized by RNA polymerase, so the enzyme would be unable to attach to the promoter and start transcription.
D) The start codon would be missing from the mRNA made from this gene, so the mRNA could not be translated.
Question
The importance of tRNA is that it

A) carries a specific amino acid to the mRNA and the ribosome.
B) reads the DNA molecule.
C) contains codons that specify amino acids.
D) is important in the construction of ribosomes.
Question
A chemical that causes the formation of covalent bonds between adenines and thymines on opposite DNA strands is added to a cell in such a way that the bonds between the nucleotides cannot be broken.How does this drug affect gene expression in the cell?

A) The chemical increases the efficiency of protein production by making it easier for tRNA to interact with the correct mRNA codons.
B) The chemical prevents transcription from occurring so that proteins cannot be made.
C) The chemical prevents protein production because once made, the RNA cannot separate from its DNA template.
D) The chemical has no effect on protein production because mRNA contains uracil rather than thymine.
Question
Which of the following is a codon?

A) U
B) UU
C) UUG
D) UUGG
Question
Most molecules of RNA are ________-stranded.
Question
Translation,a process carried out by the ribosomes,occurs in the cell ________.
Question
When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

A) insertion
B) deletion
C) frameshift
D) substitution
Question
The chemical structure of bisphenol A (BPA)resembles

A) testosterone.
B) insulin.
C) estrogen.
D) progesterone.
Question
Which of the following is NOT a mechanism used by cells to reduce gene expression?

A) looser packing of DNA
B) a specific increase in mRNA breakdown
C) modification of proteins before their translation
D) stabilization of a protein so that its "shelf-life" is increased
Question
The lac repressor stops the expression of the genes in the lac operon.It does this by binding to a gene regulatory DNA sequence that controls the expression of the genes responsible for lactose uptake and degradation.This DNA sequence is called a(n)

A) operator.
B) operon.
C) repressicon.
D) inhibiron.
Question
Each tRNA molecule has a site at one end that ________ and a site at the other end that ________.

A) acts as a promoter; acts as a terminator
B) binds to a codon; binds to an anticodon
C) binds to an amino acid; binds to a promoter
D) binds to an amino acid; binds to a codon
Question
The specific type of nucleic acid found in ribosomes,which are important in protein synthesis,is ________.
Question
It is possible for a mutation to occur and yet not alter the end product of translation if

A) the RNA polymerase skips over the mutated area.
B) the new codon encodes the same amino acid.
C) a deletion mutation removes the entire codon.
D) the mutation affects the active site of the protein product.
Question
A gene affects an organism's phenotype by controlling

A) protein production.
B) the mutation rate.
C) the organism's environment.
D) the organism's ribosomes.
Question
If a particular segment of DNA has the base sequence TAC,what will be the base sequence of the anticodon of the tRNA that carries the amino acid encoded by that stretch of DNA?

A) TAC
B) UAC
C) ATG
D) GUC
Question
The following figure depicts a gene and two different ways that gene could be mutated.How does Mutation A differ from Mutation B? <strong>The following figure depicts a gene and two different ways that gene could be mutated.How does Mutation A differ from Mutation B?  </strong> A) Mutation A does not permanently change the sequence of the gene, but Mutation B does. B) Mutation A involves the insertion of a base, whereas Mutation B involves the deletion of a base. C) Mutation A results in a possible change in one amino acid in the protein produced by the gene, but Mutation B affects several amino acids. D) Mutation A can only occur in introns, but Mutation B can occur in both introns and exons. <div style=padding-top: 35px>

A) Mutation A does not permanently change the sequence of the gene, but Mutation B does.
B) Mutation A involves the insertion of a base, whereas Mutation B involves the deletion of a base.
C) Mutation A results in a possible change in one amino acid in the protein produced by the gene, but Mutation B affects several amino acids.
D) Mutation A can only occur in introns, but Mutation B can occur in both introns and exons.
Question
The lac repressor has been mutated so that its binding site for the operator has been altered to the extent that it is unable to bind to the operator.What is the likely effect of this mutation on the lac operon?

A) The repressor will be unable to bind to the operator; the operon will bind RNA polymerase and it will thus be turned on.
B) The repressor will bind to the operator despite the mutation, and will suppress transcription of the operon in the presence and absence of lactose.
C) The lac operon will be protected by the altered repressor.
D) The repressor will be unable to bind to the operator; therefore, the ability of RNA polymerase to bind there will be severely hampered.
Question
A potential danger of a mutation to an organism is that

A) it can affect codons within the spacer DNA.
B) all mutations are fatal.
C) it can cause a change in the function of a gene's protein product.
D) it can increase the length of the introns of that organism's genome.
Question
The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

A) The repressor will be unable to bind to the operator, and the operon will thus be turned on.
B) The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose.
C) The lac operon will be degraded by the altered repressor.
D) The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there.
Question
The intermediary molecule that transmits information in a gene to a ribosome is ________.
Question
The genes that control lactose utilization (its uptake and degradation)in bacteria are arranged sequentially in the bacterial chromosome under the control of a single promoter sequence.This arrangement of genes is called a(n)

A) operator.
B) exelon.
C) operon.
D) promoton.
Question
A tRNA molecule produced in a laboratory has the anticodon for the amino acid serine,but carries the amino acid leucine.When it reaches the serine codon on a molecule of mRNA where translation is under way,what is the most likely outcome?

A) It will not bind with the codon on the mRNA molecule.
B) A potentially dysfunctional protein will result.
C) A proofreading enzyme will change leucine to serine.
D) Translation will stop.
Question
If X is a base that is inserted into each of the following DNA sequences,on which of them is it most likely to have the greatest effect on the gene's protein product?

A) AATGATATCATCCGACGXA
B) AATGATATCATCCGXACGA
C) AATGATATXCATCCGACGA
D) AXATGATATCATCCGACGA
Question
For a firefly to glow,the enzyme luciferase must catalyze a chemical reaction in the cells of the firefly.A scientist uses a chemical to induce a mutation in the luciferase gene in a strain of fireflies.Which of the following is true?

A) Even if the mutation changes the structure of the luciferase protein, it will still be able to perform the chemical reactions needed to make the firefly glow.
B) The ability of the firefly to glow may or may not be affected by the mutation.
C) The mutation will affect the structure of the mRNA made from the gene, but not the structure of the protein made from the gene.
D) Any mutation in a gene causes that gene to stop making functional proteins.
Question
An insertion or deletion mutation can cause a change in the reading of the mRNA codons; in essence,it scrambles the codons.Such a mutation results in a genetic ________.
Question
If a eukaryotic protein is to function properly,the initial mRNA carrying the code for its structure must be processed to remove its ________.Then,before translation occurs,the joining together of the remaining sequences of mRNA,the ________,must be accomplished.
Question
Gene regulatory proteins that interact with signals from the environment,both internal and external cues,and also with regulatory DNA to promote or repress gene expression are called ________.
Question
The base sequence of mRNA specifies the sequence of amino acids in a ________.
Question
If both strands of the DNA of a gene underwent transcription and translation,they would produce the same mRNA and protein.
Question
Each time transcription occurs,all the DNA in a cell is copied.
Question
Molecule B in the following image is RNA.
Molecule B in the following image is RNA.  <div style=padding-top: 35px>
Question
If a molecule of mRNA is a sentence,its bases are the letters and the codons are the ________.
Question
Proteins are produced directly from DNA,with no intermediate steps.
Question
The series of bases in mRNA that can specify a single amino acid is called a(n)________.
Question
Because they are so distantly related,the codons for serine in a black widow spider would probably be much different from the codons for serine in bluebirds.
Question
The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.
The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.  <div style=padding-top: 35px>
Question
A human-made chemical that is found in hard plastics,CDs,DVDs,shower curtains,and many other products,and that has been accused of having a variety of harmful effects like obesity and cancer is ________.
Question
Each tRNA molecule can bind with up to three codons,but carries only one specific ________.
Question
Ribosomal RNA plays a role in the formation of the covalent bonds between amino acids during translation.
Question
A sequence of DNA to which RNA polymerase binds in order to begin transcription is called the ________.
Question
A codon can specify up to three different amino acids.
Question
DNA replication involves the copying of the entire chromosome; in contrast,just a small portion of a chromosome is copied in the process of ________.
Question
Some tRNAs can recognize more than one codon because the base at the third position of their anticodon can pair with any one of two or three different bases in the codon; this phenomenon is called ________.
Question
For translation to begin,mRNA must first bind to a ________.
Unlock Deck
Sign up to unlock the cards in this deck!
Unlock Deck
Unlock Deck
1/88
auto play flashcards
Play
simple tutorial
Full screen (f)
exit full mode
Deck 12: From Gene to Protein
1
As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

A) promoter.
B) intron.
C) start codon.
D) anticodon.
A
2
Which of the following is true of rRNA?

A) It is made up of base pairs.
B) It carries amino acids.
C) It is not translated.
D) It helps transcribe DNA.
C
3
Which of the following would be found only in RNA?

A) deoxyribose and uracil
B) ribose and thymine
C) ribose and uracil
D) deoxyribose and thymine
C
4
Which of the following is true of transcription?

A) It destroys the DNA template.
B) The DNA molecule must unwind.
C) Base pairing is unimportant.
D) The end result is a protein.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
5
The sugar molecule present in RNA is

A) uracil.
B) deoxyribose.
C) ribose.
D) sucrose.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
6
Protein coding genes specify the manufacture of ________ as their immediate product.

A) rRNA
B) tRNA
C) DNA
D) mRNA
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
7
Following transcription,the

A) strands of DNA bond back to each other.
B) mRNA is digested.
C) DNA molecule is broken down.
D) ribosome is released from the tRNA molecule.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
8
DNA molecules are double-stranded,whereas most RNA molecules are single-stranded.Which of the following choices is the most likely reason that RNA does NOT need to be double-stranded?

A) DNA reproduces itself directly, whereas RNA does not.
B) RNA reproduces itself directly, whereas DNA does not.
C) DNA undergoes translation that requires the use of both strands at the same time.
D) RNA undergoes transcription that can only read one strand at a time.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
9
The sequence of nucleotides in an mRNA molecule

A) is complementary to the DNA template strand.
B) matches the sequence of the ribosome that will translate the mRNA.
C) exactly matches the template strand (except where U is substituted for T).
D) is identical to that of the promoter.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
10
Which of the following is the best and most complete description of the function of genes?

A) They control the production of enzymes.
B) They control the production of structural proteins.
C) They control the production of all proteins.
D) They control the production of amino acids.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
11
Which of the following does NOT take place in the nucleus?

A) transcription
B) RNA splicing
C) replication
D) translation
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
12
During transcription

A) the DNA strands replicate, producing four mRNA molecules.
B) each strand in the DNA molecule directs the production of an mRNA molecule.
C) a template strand of DNA directs the production of an mRNA molecule.
D) a template strand of DNA directs only the production of all the tRNA molecules needed for producing the gene's protein product.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
13
The information in a gene is encoded by the

A) introns of eukaryotic cells.
B) amino acids that make up the genes.
C) base sequences of the gene's DNA.
D) rRNA that transfers amino acids to ribosomes.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
14
The key enzyme used during transcription is

A) RNA polymerase.
B) DNA polymerase.
C) rRNA.
D) terminase.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
15
The order of the bases in DNA determines the order of the

A) amino acids in DNA.
B) bases in a protein.
C) amino acids in mRNA.
D) bases in mRNA.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
16
A promoter would be located on

A) the template strand of a DNA molecule.
B) the anticodon of a tRNA molecule.
C) an mRNA molecule.
D) RNA polymerase.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
17
If a strand of DNA has the sequence CGTAA,the mRNA made from this molecule will have the sequence

A) CGTAA.
B) GCUTT.
C) TAGCC.
D) GCAUU.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
18
The bases present in an RNA molecule are

A) C, T, A, and G.
B) U, A, C, and G.
C) G, C ,U, and T.
D) U, C, T, and A.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
19
Prokaryotes lack membrane-bound organelles and thus do not have nuclei; therefore

A) prokaryotes are unable to undergo transcription and translation.
B) prokaryotic cells do not need to undergo translation.
C) prokaryotic transcription and translation both take place in the cytoplasm.
D) prokaryotes are unable to replicate their DNA.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
20
How does a molecule of RNA polymerase "know" which of the two strands of DNA it should use as a template strand?

A) RNA polymerase recognizes the start codon.
B) RNA polymerase binds to the promoter in a specific orientation that determines which DNA strand it will be able to "read."
C) The ribosome binds to the promoter in a specific orientation that determines which DNA strand it will be able to "read."
D) RNA polymerase binds randomly to one strand or the other, so that roughly half of its attachments to DNA result in the production of the correct mRNA.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
21
Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? <strong>Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?  </strong> A) tyrosine-tyrosine-alanine B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine C) methionine-proline-glutamate D) methionine-proline-glutamate-isoleucine-alanine

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
22
Which of the following is NOT a feature of the genetic code?

A) Every individual has a different genetic code.
B) Each codon in the genetic code specifies only one amino acid.
C) The genetic code is redundant.
D) The same genetic code can be applied to virtually every organism on Earth.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
23
The process depicted in the following figure takes place in <strong>The process depicted in the following figure takes place in  </strong> A) prokaryotic cells. B) eukaryotic cells. C) both prokaryotic and eukaryotic cells. D) all cells involved in protein production.

A) prokaryotic cells.
B) eukaryotic cells.
C) both prokaryotic and eukaryotic cells.
D) all cells involved in protein production.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
24
Which molecules are involved in translation?

A) DNA and RNA
B) mDNA, tDNA, and rDNA
C) mRNA, tRNA, and rRNA
D) proteins, amino acids, and DNA
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
25
What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation? <strong>What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation?  </strong> A) AGC B) UGC C) TGC D) serine

A) AGC
B) UGC
C) TGC
D) serine
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
26
Bacteria and humans use the same DNA components,and both kinds of cells also perform transcription and translation.Which of the following choices is a potentially significant outcome of this shared mechanism?

A) Bacteria are able to transcribe and translate human DNA; thus, they potentially could produce human proteins.
B) Bacteria are able to transcribe and translate human DNA; thus, they could evolve into humans.
C) Bacterial and human proteins are identical in amino acid sequence because the mechanism for producing them is the same.
D) Bacterial and human DNA are identical in sequence because the method for producing them is the same.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
27
Each set of three bases in an mRNA molecule codes for one of 20 specific

A) rRNA molecules.
B) nucleotides.
C) amino acids.
D) proteins.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
28
Which of the lettered arrows in the following diagram of translation indicates a codon? <strong>Which of the lettered arrows in the following diagram of translation indicates a codon?  </strong> A) A B) B C) C D) D

A) A
B) B
C) C
D) D
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
29
Which of the following results would most likely occur if introns were not removed from newly made mRNA?

A) The introns along with the exons could be used to produce the proteins the cell needs.
B) The resulting protein would be longer than if the introns were removed.
C) The resulting DNA would not code for the correct gene.
D) The resulting rRNA would not code for the correct protein.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
30
In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result

A) more RNA for aromatase is produced.
B) less RNA for aromatase is produced.
C) the production of aromatase is inhibited.
D) aromatase is degraded by other enzymes in the cell.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
31
In the genetic code,an amino acid is specified by

A) a stop codon.
B) rRNA.
C) a series of four introns.
D) a sequence of three mRNA bases.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
32
Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG? <strong>Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG?  </strong> A) ACAUGCUAUAUCCCG B) ACATGCTATATCCCG C) cysteine-threonine-isoleucine-glycine D) cysteine-threonine-isoleucine-glycine-stop

A) ACAUGCUAUAUCCCG
B) ACATGCTATATCCCG
C) cysteine-threonine-isoleucine-glycine
D) cysteine-threonine-isoleucine-glycine-stop
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
33
During translation

A) many mRNA molecules work with one tRNA molecule and one rRNA molecule to produce a protein.
B) one tRNA molecule works with paired mRNA molecules and many rRNA molecules to produce a protein.
C) strings of bonded tRNA molecules work with one mRNA molecule and one rRNA molecule to produce a protein.
D) one mRNA molecule works with several rRNA molecules and many tRNA molecules to produce a protein.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
34
Consider a build-at-home bookshelf that comes with instructions and various pieces of wood as an analogy for translation.In this analogy,what would best match the job of the ribosome?

A) the instructions
B) the person building the bookshelf
C) the pieces of wood
D) the bookshelf
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
35
During RNA splicing

A) introns are removed from RNA, and the remaining exons are connected to form a mature mRNA.
B) an RNA molecule is cut up into many small pieces and each piece forms a single mRNA.
C) exons are removed from RNA and the remaining introns are fused to form a single mRNA.
D) RNA is used to remove mutations from essential genes.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
36
In bacteria,the antibiotic tetracycline blocks the site where tRNA molecules enter the ribosome.The most likely reason that bacteria die from treatment with tetracycline is because the antibiotic

A) inhibits the cell from producing the mRNA.
B) causes the tRNA molecules to randomly arrange into proteins that do not function.
C) causes tRNA rather than mRNA to be made into proteins.
D) prevents the bacteria from assembling essential proteins.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
37
A mutation occurs in the promoter of a protein-encoding gene.How might this mutation affect the production of the protein encoded by the gene?

A) The mRNA made from this gene would exhibit the same mutation and therefore would not fold or function properly.
B) The protein made from the promoter would have a different amino acid sequence and therefore would not function properly.
C) The promoter might not be recognized by RNA polymerase, so the enzyme would be unable to attach to the promoter and start transcription.
D) The start codon would be missing from the mRNA made from this gene, so the mRNA could not be translated.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
38
The importance of tRNA is that it

A) carries a specific amino acid to the mRNA and the ribosome.
B) reads the DNA molecule.
C) contains codons that specify amino acids.
D) is important in the construction of ribosomes.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
39
A chemical that causes the formation of covalent bonds between adenines and thymines on opposite DNA strands is added to a cell in such a way that the bonds between the nucleotides cannot be broken.How does this drug affect gene expression in the cell?

A) The chemical increases the efficiency of protein production by making it easier for tRNA to interact with the correct mRNA codons.
B) The chemical prevents transcription from occurring so that proteins cannot be made.
C) The chemical prevents protein production because once made, the RNA cannot separate from its DNA template.
D) The chemical has no effect on protein production because mRNA contains uracil rather than thymine.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
40
Which of the following is a codon?

A) U
B) UU
C) UUG
D) UUGG
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
41
Most molecules of RNA are ________-stranded.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
42
Translation,a process carried out by the ribosomes,occurs in the cell ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
43
When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

A) insertion
B) deletion
C) frameshift
D) substitution
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
44
The chemical structure of bisphenol A (BPA)resembles

A) testosterone.
B) insulin.
C) estrogen.
D) progesterone.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
45
Which of the following is NOT a mechanism used by cells to reduce gene expression?

A) looser packing of DNA
B) a specific increase in mRNA breakdown
C) modification of proteins before their translation
D) stabilization of a protein so that its "shelf-life" is increased
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
46
The lac repressor stops the expression of the genes in the lac operon.It does this by binding to a gene regulatory DNA sequence that controls the expression of the genes responsible for lactose uptake and degradation.This DNA sequence is called a(n)

A) operator.
B) operon.
C) repressicon.
D) inhibiron.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
47
Each tRNA molecule has a site at one end that ________ and a site at the other end that ________.

A) acts as a promoter; acts as a terminator
B) binds to a codon; binds to an anticodon
C) binds to an amino acid; binds to a promoter
D) binds to an amino acid; binds to a codon
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
48
The specific type of nucleic acid found in ribosomes,which are important in protein synthesis,is ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
49
It is possible for a mutation to occur and yet not alter the end product of translation if

A) the RNA polymerase skips over the mutated area.
B) the new codon encodes the same amino acid.
C) a deletion mutation removes the entire codon.
D) the mutation affects the active site of the protein product.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
50
A gene affects an organism's phenotype by controlling

A) protein production.
B) the mutation rate.
C) the organism's environment.
D) the organism's ribosomes.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
51
If a particular segment of DNA has the base sequence TAC,what will be the base sequence of the anticodon of the tRNA that carries the amino acid encoded by that stretch of DNA?

A) TAC
B) UAC
C) ATG
D) GUC
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
52
The following figure depicts a gene and two different ways that gene could be mutated.How does Mutation A differ from Mutation B? <strong>The following figure depicts a gene and two different ways that gene could be mutated.How does Mutation A differ from Mutation B?  </strong> A) Mutation A does not permanently change the sequence of the gene, but Mutation B does. B) Mutation A involves the insertion of a base, whereas Mutation B involves the deletion of a base. C) Mutation A results in a possible change in one amino acid in the protein produced by the gene, but Mutation B affects several amino acids. D) Mutation A can only occur in introns, but Mutation B can occur in both introns and exons.

A) Mutation A does not permanently change the sequence of the gene, but Mutation B does.
B) Mutation A involves the insertion of a base, whereas Mutation B involves the deletion of a base.
C) Mutation A results in a possible change in one amino acid in the protein produced by the gene, but Mutation B affects several amino acids.
D) Mutation A can only occur in introns, but Mutation B can occur in both introns and exons.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
53
The lac repressor has been mutated so that its binding site for the operator has been altered to the extent that it is unable to bind to the operator.What is the likely effect of this mutation on the lac operon?

A) The repressor will be unable to bind to the operator; the operon will bind RNA polymerase and it will thus be turned on.
B) The repressor will bind to the operator despite the mutation, and will suppress transcription of the operon in the presence and absence of lactose.
C) The lac operon will be protected by the altered repressor.
D) The repressor will be unable to bind to the operator; therefore, the ability of RNA polymerase to bind there will be severely hampered.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
54
A potential danger of a mutation to an organism is that

A) it can affect codons within the spacer DNA.
B) all mutations are fatal.
C) it can cause a change in the function of a gene's protein product.
D) it can increase the length of the introns of that organism's genome.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
55
The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

A) The repressor will be unable to bind to the operator, and the operon will thus be turned on.
B) The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose.
C) The lac operon will be degraded by the altered repressor.
D) The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
56
The intermediary molecule that transmits information in a gene to a ribosome is ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
57
The genes that control lactose utilization (its uptake and degradation)in bacteria are arranged sequentially in the bacterial chromosome under the control of a single promoter sequence.This arrangement of genes is called a(n)

A) operator.
B) exelon.
C) operon.
D) promoton.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
58
A tRNA molecule produced in a laboratory has the anticodon for the amino acid serine,but carries the amino acid leucine.When it reaches the serine codon on a molecule of mRNA where translation is under way,what is the most likely outcome?

A) It will not bind with the codon on the mRNA molecule.
B) A potentially dysfunctional protein will result.
C) A proofreading enzyme will change leucine to serine.
D) Translation will stop.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
59
If X is a base that is inserted into each of the following DNA sequences,on which of them is it most likely to have the greatest effect on the gene's protein product?

A) AATGATATCATCCGACGXA
B) AATGATATCATCCGXACGA
C) AATGATATXCATCCGACGA
D) AXATGATATCATCCGACGA
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
60
For a firefly to glow,the enzyme luciferase must catalyze a chemical reaction in the cells of the firefly.A scientist uses a chemical to induce a mutation in the luciferase gene in a strain of fireflies.Which of the following is true?

A) Even if the mutation changes the structure of the luciferase protein, it will still be able to perform the chemical reactions needed to make the firefly glow.
B) The ability of the firefly to glow may or may not be affected by the mutation.
C) The mutation will affect the structure of the mRNA made from the gene, but not the structure of the protein made from the gene.
D) Any mutation in a gene causes that gene to stop making functional proteins.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
61
An insertion or deletion mutation can cause a change in the reading of the mRNA codons; in essence,it scrambles the codons.Such a mutation results in a genetic ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
62
If a eukaryotic protein is to function properly,the initial mRNA carrying the code for its structure must be processed to remove its ________.Then,before translation occurs,the joining together of the remaining sequences of mRNA,the ________,must be accomplished.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
63
Gene regulatory proteins that interact with signals from the environment,both internal and external cues,and also with regulatory DNA to promote or repress gene expression are called ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
64
The base sequence of mRNA specifies the sequence of amino acids in a ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
65
If both strands of the DNA of a gene underwent transcription and translation,they would produce the same mRNA and protein.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
66
Each time transcription occurs,all the DNA in a cell is copied.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
67
Molecule B in the following image is RNA.
Molecule B in the following image is RNA.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
68
If a molecule of mRNA is a sentence,its bases are the letters and the codons are the ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
69
Proteins are produced directly from DNA,with no intermediate steps.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
70
The series of bases in mRNA that can specify a single amino acid is called a(n)________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
71
Because they are so distantly related,the codons for serine in a black widow spider would probably be much different from the codons for serine in bluebirds.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
72
The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.
The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
73
A human-made chemical that is found in hard plastics,CDs,DVDs,shower curtains,and many other products,and that has been accused of having a variety of harmful effects like obesity and cancer is ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
74
Each tRNA molecule can bind with up to three codons,but carries only one specific ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
75
Ribosomal RNA plays a role in the formation of the covalent bonds between amino acids during translation.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
76
A sequence of DNA to which RNA polymerase binds in order to begin transcription is called the ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
77
A codon can specify up to three different amino acids.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
78
DNA replication involves the copying of the entire chromosome; in contrast,just a small portion of a chromosome is copied in the process of ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
79
Some tRNAs can recognize more than one codon because the base at the third position of their anticodon can pair with any one of two or three different bases in the codon; this phenomenon is called ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
80
For translation to begin,mRNA must first bind to a ________.
Unlock Deck
Unlock for access to all 88 flashcards in this deck.
Unlock Deck
k this deck
locked card icon
Unlock Deck
Unlock for access to all 88 flashcards in this deck.