Deck 13: Translation of Mrna

Question 1

Select the amino acid that has been activated by aminoacyl-tRNA synthetase.

A) Amino acid · ATP · aminoacyl-tRNA synthetase
B) Amino acid · aminoacyl-tRNA synthetase
C) Amino acid + AMP + PPi
D) Amino acid · AMP

Answer 1

D

Question 2

Select the codon that is not synonymous with CUU.

A) CUC
B) UUG
C) CUA
D) AUU
E) UUA

Answer 2

D

Question 3

Select the statements that are true regarding the experiments by Beadle and Tatum (check all that apply).

A) They used the mold Neurospora as a model organism.
B) They isolated strains that could not grow on minimal media.
C) They established the link between a gene and an enzyme or protein.
D) They were able to create loss-of-function mutations in any enzyme they chose.

Answer 3

A, B, C

Question 4

A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?

A) Glycine
B) Proline
C) Alanine
D) Arginine

Question 5

What site does the initiator tRNA bind to on the ribosome?

A) A
B) E
C) P

Question 6

An anticodon is located on ________.

A) DNA
B) mRNA
C) rRNA
D) tRNA
E) snRNA

Question 7

What is responsible for binding the initiator tRNA in eukaryotes?

A) eIF2
B) EF-Tu
C) eIF3
D) EF-G

Question 8

Kozak's rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at -35 and -10. Where is the consensus sequence for translational initiation according to Kozak's rules?

A) -6 to +4
B) -12 to -2
C) +1 to +10
D) -9 to +1

Question 9

A tRNA that has an amino acid attached is called ________.

A) an rRNA
B) a degenerate tRNA
C) a coding tRNA
D) a charged tRNA
E) None of the answers are correct

Question 10

What site on the ribosome is primarily responsible for holding the growing polypeptide?

A) A
B) E
C) P

Question 11

All mature polypeptides contain a methionine at the N-terminus.

Question 12

Taking into account your knowledge of wobble rules, select all anticodons that can pair with the codon 5'-UAC-3' (Check all that apply).

A) 5'-AUG-3'
B) 5'-IUA-3'
C) 5'-AUA-3'
D) 5'-GUA-3'
E) 5'-GUI-3'

Question 13

Select all stop codons.

A) UGA
B) UAA
C) UAG
D) AUG
E) UUA

Question 14

61 different tRNAs are required for translation both in vivo and in vitro.

Question 15

α-helices and β-sheets are examples of what level of protein structure?

A) Primary structure
B) Secondary structure
C) Tertiary structure
D) Quaternary structure

Question 16

The primary structure of a protein is directly associated with ________.

A) regular repeating shapes, such as beta-sheets
B) the three-dimensional shape of the protein
C) the linear sequence of the amino acids
D) the interaction of two or more peptide chains

Question 17

The genetic code is nearly universal in nuclear DNA from bacteria to mammals.

Question 18

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

A) 7
B) 8
C) 10
D) 13

Question 19

What is true according to the adaptor hypothesis?

A) The anticodon and amino acid have no relationship.
B) A given tRNA can carry any of the twenty amino acids.
C) The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid.
D) An amino acid recognizes the codon in mRNA.

Question 20

Where are the ribosomal subunits assembled in eukaryotes?

A) Nucleus
B) Nucleoid
C) Nucleolus
D) Nuclear envelope

Question 21

What typically stops the process of translation?

A) Rho proteins
B) Aminoacyl tRNA synthase
C) rRNA
D) Stop codons
E) Introns

Question 22

You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

A) 36%
B) 22%
C) 14%
D) 28%

Question 23

Transcription and translation may occur simultaneously in prokaryotic cells.

Question 24

Where does mRNA/tRNA codon-anticodon recognition take place?

A) 30S
B) 40S
C) 50S
D) The surface between the two ribosomal subunits

Question 25

The anticodon on the mRNA recognizes the codon on the tRNA.

Question 26

During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Question 27

You have cloned a gene for a mammalian mitochondrial protein that is rich in tryptophan. If you translate this protein in the cytoplasm rather than the mitochondria, what result do you expect?

A) The protein will be shorter than its mitochondrial counterpart.
B) The protein will be longer than its mitochondrial counterpart.
C) The protein will be the same as its mitochondrial counterpart.
D) The protein will contain completely different amino acids when compared to its mitochondrial counterpart.

Question 28

RF1 and RF2 are active during ________.

A) initiation
B) elongation
C) termination
D) peptidyl transfer

Question 29

The C-terminus of a polypeptide always contains

A) a stop codon.
B) a carboxyl group.
C) an amino group.
D) carbon dioxide.
E) None of the answers are correct.

Question 30

You perform a cell free translation experiment like Nirenberg and Matthaei, but you forget to write down what nucleotides you added to make the mRNA. You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine, and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA?

A) Equal amounts of A, C, U, and G
B) 50% C and 50% A
C) 70% C and 30% A
D) 50% C and 50% U
E) 50% A and 50% G

Question 31

Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from? 5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'

A) 1st
B) 2nd
C) 3rd
D) 4th

Question 32

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

A) 125 nucleotides.
B) 376 nucleotides.
C) 1128 nucleotides.
D) 3384 nucleotides.

Question 33

The peptidyl transferase is a component of

A) DNA.
B) tRNA.
C) the ribosome.
D) the protein being translated.
E) mRNA.

Question 34

The decoding function is conducted by

A) the 16S rRNA.
B) tRNA.
C) mRNA.
D) snRNA.
E) aminoacyl-tRNA synthetase.

Question 35

You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit? (Assume pathway intermediates are not available from sources outside the phenylalanine breakdown pathway.)

A) This person will exhibit symptoms of alkaptonuria.
B) This person will exhibit symptoms of tyrosinosis.
C) This person will exhibit symptoms of phenylketonuria.
D) This person will exhibit symptoms of alkaptonuria and phenylketonuria.
E) This person will be phenotypically normal.

Question 36

The structure of the ribosome is uniform throughout a eukaryotic cell.

Question 37

Suppose you performed a triplet binding assay with the triplet 5'-UAA-3'. What radiolabeled amino acids do you expect to find bound to the filter?

A) Tyrosine
B) Asparagine
C) Methionine
D) None

Question 38

What is the name of the enzyme that adds CCA to the 3' end of tRNAs?

A) tRNA nucleotidyltransferase
B) Aminoacyl-tRNA synthetase
C) RNA polymerase
D) Peptidyl transferase

Question 39

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

A) 1
B) 2
C) 3
D) 4