iGenetics 3rd Edition by Peter Russell

Exercise 3

A dot plot provides a straightforward way to identify similar regions in pairs of sequences. In a dot plot, one sequence is written along the X-axis on a sheet of graph paper, and the second sequence is written along the Y-axis. A dot is placed in the plot whenever the nucleotide in a column on the X-axis matches the nucleotide in a row on the Y-axis.
a. Construct a dot plot for each of the following pairs of sequences, and then state where the plot reveals regions of similarity between each pair of sequences.
i. GCATTTAGAGCCCTAGTCGTGACAG
ATTCAGTTAGAGCCCTAGCTGATTGC
ii. AGCGATTGGTCCTGTACGAGCTAA
GATGCACCTGTACGAGCCTTA
b. Consider the results of your dot plots. What are some of the issues that the BLAST program, which performs sequence similarity searches between a query sequence and sequences in a database, must address?