Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA? 
A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Correct Answer:
Verified
Q1: As transcription begins,RNA polymerase binds to a
Q2: Which of the following is true of
Q3: Which of the following does NOT take
Q5: Protein coding genes specify the production of
Q9: During transcription,
A) the DNA strands replicate, producing
Q20: A human gene put into a plant
Q22: Which of the following codons codes for
Q24: Which molecules are involved in translation?
A) DNA
Q33: During translation
A) many mRNA molecules work with
Q33: Which RNA molecule brings new amino acids
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents