In frogs, green skin is determined by gene B.The wild-type sequence of the 5′ end of the RNA-like strand of the entire first exon is shown below.The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5′ ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3′
The table of codons is provided here: 
-Which are the first three amino acids encoded by the wild-type sequence of gene B?
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.
Correct Answer:
Verified
Q19: What is one difference between using restriction
Q20: What is the origin and physiological function
Q21: Why is it necessary to obtain overlapping
Q22: The sequence of gene B from another
Q23: Baby frog #1 is homozygous for a
Q24: A third mutant allele of gene B
Q25: Which method of fragmenting DNA would not
Q26: Why does a genomic library need more
Q28: Baby frog #1 was born with brown
Q29: Why was another nucleotide not added to
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents