Question 1

A codon that specifies the amino acid Ile undergoes a single-base substitution to become the amino acid Met. Which of the following describes the type of mutation that must have occurred?

Accepted Answer

The answer of A codon that specifies the amino acid...

Question 2

Reversions, or reverse mutations (i.e., mutations that restore the wild-type phenotype initially lost by an earlier mutation), can be either of two types: back mutations or suppressor mutations. Explain how you could distinguish between these two different types of reversions using a test cross.

Accepted Answer

The answer of Reversions, or reverse mutations (i.e., mutations that...

Question 3

A DNA sequence encodes a protein with the amino acid sequence Met-Leu-Ser-Ile-Met-Ala. A mutation occurs in the DNA sequence so that now it encodes a protein with the amino acid sequence Met-Leu-Val.
a. Propose an explanation for the type of mutation that produces the new amino acid sequence.
b. Give an example of a second mutation that would produce the following amino acid sequence: Met-Leu-Val-Ile-Met-Ala.

Accepted Answer

The answer of A DNA sequence encodes a protein with...

Question 4

How do intergenic and intragenic suppressor mutations differ?

Accepted Answer

The answer of How do intergenic and intragenic suppressor mutations...

Question 5

What is the difference between a missense mutation and a nonsense mutation?

Accepted Answer

The answer of What is the difference between a missense...

Question 6

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Thr-Gly-Thr-Ile-Thr. Which describes the MOST likely type of mutation that occurred?

Accepted Answer

A frameshift mutation is likely because the mutant sequence is longer and has different amino acids after the mutation point, indicating a shift in the reading frame.

Question 7

A single base substitution caused the amino acid sequence Met-His-Glu-Cys to be changed to Met-His. Which of the following describes the type of mutation that caused this change?

Accepted Answer

The answer of A single base substitution caused the amino...

Question 8

The following sequence represents the DNA template strand of a gene:  a. Give the sequence of the mRNA transcribed from this DNA strand and, using the genetic code provided in Figure 15.12, give the amino acid sequence of the protein it encodes.

b. Give the amino acid sequence of the protein encoded by this sequence after the following mutations have occurred:
- a transition at nucleotide #10
- a transition at nucleotide #12
- atransition at nucleotide #7
- an insertion of a "G" immediately following nucleotide #10

Accepted Answer

The answer of The following sequence represents the DNA template...

Question 9

How do mutation rates differ among eukaryotic and prokaryotic organisms? What factors affect mutation rates?

Accepted Answer

The answer of How do mutation rates differ among eukaryotic...

Question 10

Tumor suppressor proteins can assist in slowing down the cell cycle under appropriate conditions. In humans, the TP53 gene encodes a tumor suppressor called p53. Most mutations in the TP53 gene result in a mutant form of p53 that can no longer function to slow down the cell cycle, which can lead to a cell becoming cancerous. However, some mutant forms of p53 actually possess the ability to increase a cell's resistance to anticancer treatments. Which of the following BEST describes this type of mutation?

Accepted Answer

A gain-of-function mutation results in a protein acquiring new or enhanced activities. In this case, the mutant p53 not only loses its original function but also gains a new function that increases resistance to anticancer treatments.

Question 11

A diploid fungal cell is homozygous for a (TTG)₅ trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.) ATGTTGTTGTTGTTGTTGTGA

Accepted Answer

The answer of A diploid fungal cell is homozygous for...

Question 12

Explain how an individual with a suppressor mutation can be a double mutant but express a near normal phenotype.

Accepted Answer

The answer of Explain how an individual with a suppressor...

Question 13

Helen has type I osteogenesis imperfecta (OI), a genetic skeletal disorder. Shown below is her DNA sequence for a portion of the coding region of the collagen type I gene, which contains the mutation responsible for her disorder. The corresponding wild-type sequence is shown also (only one DNA strand is shown in each case).  What type of mutation does Helen carry?

Accepted Answer

The answer of Helen has type I osteogenesis imperfecta (OI),...

Question 14

List all single-base substitutions that would change a codon for Leu to a nonsense codon (see Figure 15.12). For each, indicate whether it would be a transition or transversion.

Accepted Answer

The answer of List all single-base substitutions that would change...

Question 15

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred?

Accepted Answer

The mutation changed Arg (Arginine) to Gly (Glycine), which is a single amino acid substitution, characteristic of a missense mutation.

Question 16

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Accepted Answer

The answer of Why do insertions and deletions often have...

Question 17

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala. Which describes the MOST likely type of mutation that occurred?

Accepted Answer

A nonsense mutation introduces a premature stop codon, leading to a truncated polypeptide, which is consistent with the mutant sequence ending after Met-Ala.

Question 18

What are the differences between neutral mutations and silent mutations?

Accepted Answer

The answer of What are the differences between neutral mutations...

Question 19

A geneticist is studying a mutation in a population of turtles that causes their shells to become extremely brittle. She determines the mutation is caused by the loss of two nucleotides in the coding region of a gene. Upon studying the mutant protein that is produced, she observes that it is 312 amino acids in length, as compared to the normal protein that is 588 amino acids in length. This mutant protein can no longer carry out its normal function of assisting in the Difficultening of a turtle's shell. Which of the following could NOT describe this mutation?

Accepted Answer

A transversion is a type of point mutation where a purine is replaced with a pyrimidine or vice versa. The mutation described involves the loss of two nucleotides, which is not a transversion.

Question 20

You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below-the mutation is set in boldface type). Among a population of fish having the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant? (Use a genetic rather than a biochemical classification.) Original sequence: atgtgtcctatgtgagttgcggcttgttg
Mutant sequence: atg g tgtcctatgtgagttgcggctgttg
Variant sequence: atg g tgtcctatgtgagttgcggcttg g tg

Accepted Answer

The answer of You are working on an insulin-binding protein...

Quiz 18: Gene Mutations and Dna Repair