The Sequence Below Represents a Pre-MRNA

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

A) The U2 snRNA would not be able to bind to the branch point because it could not recognize it.
B) The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site.
C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.
D) Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site.
E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.