How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'
A) 7
B) 8
C) 10
D) 13
Correct Answer:
Verified
Q11: All mature polypeptides contain a methionine at
Q16: Adenine can base pair with cytosine and
Q17: Which of the following is not true
Q18: Kozack's rules for translation are similar to
Q19: A tRNA that has an amino acids
Q21: A polyribosome would be found in which
Q22: The wobble base is usually associated with
Q23: The Shine-Dalgarno sequence is found in eukaryotic
Q24: The peptidyltransferase complex is a component of
Q25: Proteins that are composed of two or
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents