The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q44: DNA moves toward the _ charged end
Q51: _ catalyzes the formation of covalent bonds
Q54: A _ is a small, circular portion
Q57: A DNA _ that binds to a
Q59: The polymerase chain reaction (PCR) uses a
Q70: There are no risks associated with DNA
Q72: It is theoretically impossible for two individuals
Q76: DNA fingerprinting can prove guilt without fail.
Q89: Genetically modified plants can pass their recombinant
Q92: Restriction enzymes work only on bacterial DNA.
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents