Solved

Which of the Following Fragments Would Be Generated When the Following

Question 11

Multiple Choice

Which of the following fragments would be generated when the following sequence is cut by SmaI?
5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3'


A) One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment
B) One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment
C) Two 19 bp fragments
D) One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents