What occurs during the annealing stage of a PCR reaction?
A) The DNA strands separate
B) The DNA polymerase copies the template DNA.
C) The primers bind to the template DNA.
D) The reaction stops.
Correct Answer:
Verified
Q8: What is the origin of restriction endonucleases?
A)
Q9: DNA ligase is needed in a cloning
Q10: Site-directed mutagenesis allows researchers to produce a
Q11: What is the purpose of RT(reverse transcriptase)-PCR?
A)
Q12: A cDNA library differs from a genomic
Q16: In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you
Q17: cDNA is made using what as the
Q18: Which of the following individual(s)developed the process
Q19: Which of the following would contain both
Q20: What is the purpose of RNaseH in
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents