Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?
A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Correct Answer:
Verified
Q22: Which of the following is NOT a
Q26: Bacteria and humans use the same DNA
Q29: Which of the following results would most
Q30: In humans,the herbicide atrazine helps RNA polymerase
Q31: In the genetic code,an amino acid is
Q33: During translation
A) many mRNA molecules work with
Q34: The process depicted in the following figure
Q35: During RNA splicing
A) introns are removed from
Q36: In bacteria,the antibiotic tetracycline blocks the site
Q47: Each tRNA molecule has a site at
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents