Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12:
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?
A) Mary and Bob are most likely fraternal twins.
B) Mary has five STRs at this site;Bob has two.
C) Mary has one STR at this site;Bob has none.
D) The DNA shown must be from the 23rd chromosome,not the 12th.
E) None of the above.
Correct Answer:
Verified
Q109: What is gel electrophoresis?
A) A laboratory technique
Q110: What is the correct sequence in
Q111: The use of DNA in forensic science
Q112: One commonly used STR is called "TH01,"
Q113: Where is DNA found?
A) chromosomes
B) blood
C) saliva
D)
Q115: Whose DNA will be most similar to
Q116: Some problems with use of DNA analysis
Q117: PCR of a single STR can produce
Q118: You are a juror at a trial
Q119: DNA analysis is used in
A) paternity suits.
B)
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents