Solved

Given the Following Aligned Sequences Identify Any Transitions and Transversions as Well as Any Synonymous

Question 40

Essay

Given the following aligned sequences
Sequence 1Sequence 2Sequence 3SequenceATAATAATCATCTGTTGTTGTTGGATATAAATAATAAAAAAGAGGAGG\begin{array}{c}\begin{array}{lll} \text {Sequence 1}\\ \text {Sequence 2}\\ \text {Sequence 3}\\ \text {Sequence} \end{array}\begin{array}{lll} \text {ATA}\\ \text {ATA}\\ \text {ATC}\\ \text {ATC}\end{array}\begin{array}{lll} \text {TGT}\\ \text {TGT}\\ \text {TGT}\\ \text {TGG}\end{array}\begin{array}{lll} \text {ATA}\\ \text {TAA}\\ \text {ATA}\\ \text {ATA}\end{array}\begin{array}{lll} \text {AAA}\\ \text {AAG}\\ \text {AGG}\\ \text {AGG}\end{array}\end{array}

identify any transitions and transversions as well as any synonymous and nonsynonymous substitutions.

Correct Answer:

verifed

Verified

First codon: A to C: transversion,synony...

View Answer

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents