A DNA sequence has been cut into the following four overlapping sequence fragments:
(1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?
A) 1, 2, 3, 4
B) 1, 3, 2, 4
C) 2, 3, 1, 4
D) 4, 1, 2, 3
E) 4, 1, 3, 2
Correct Answer:
Verified
Q13: A stretch of one strand of a
Q14: A promoter is an example of a(n)
A)
Q15: Which case best fits the description of
Q16: A DNA sequence has been cut into
Q17: Under which circumstance will a researcher most
Q19: Which sequence type will not be included
Q20: The noncoding strand of a 10 bp
Q21: Refer to the table showing several prokaryote
Q22: Refer to the table showing the properties
Q23: Refer to the hypothetical data set comparing
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents