The following sequences were obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
How many differences have arisen between D.melanogaster and D.erecta sequences?
Correct Answer:
Verified
Q234: Molecular evolutionists study relationships between the _
Q235: A gene that codes for a cardiac
Q236: When comparing the amino acid sequences of
Q237: The comparison of the amino acid sequences
Q238: In the mammalian body, you would find
Q240: Refer to the figure. Q241: The sea snake is resistant to poisoning Q242: The globin gene family is an example Q243: Refer to the figure. Q244: How do bioprospecting and in vitro evolution![]()
![]()
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents