The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed substitution is equivalent to 2 nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.
Correct Answer:
Verified
Q216: Biased gene conversion would tend to _
Q217: Biologists use a chemical derived from a
Q218: A gene involved in immunity duplicates within
Q219: Which possible mechanism of concerted evolution would
Q220: Consider the case of in vitro evolution
Q222: The bacterium Thermus aquaticus produces a reverse
Q223: Which statement about synonymous mutations is true?
A)
Q224: Amino acid sequences of a homologous protein
Q225: Homologous genes from three different species are
Q226: Major influenza epidemics are typically triggered by
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents