Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How would you align the three sequences so that they could be used for making comparisons?
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q89: The developmental genes bicoid and zen are
Q90: A sequence of DNA that arose from
Q91: Use the following to answer questions :
Sequences
Q92: Suppose the ancestral nucleotide at position 786
Q94: The enzyme _ has evolved new functions
Q95: Many more synonymous than nonsynonymous substitutions have
Q96: Chorion genes are involved in making the
Q98: A group of homologous genes with related
Q106: Biologists who are searching for a natural
Q117: Two species of pine trees differ by
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents