Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-If we assume that a gap is equivalent to two nucleotide substitutions, how many substitutions have occurred between D. melanogaster and D. erecta?
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q77: The hands of humans and the wings
Q78: The primary function of ribosomal RNA genes
Q79: When researchers apply the principles of evolution
Q80: Biased gene conversion is a mechanism of
A)
Q82: Genes found in different species whose divergence
Q83: Use the following to answer questions :
Suppose
Q84: In their studies of evolution within Pseudomonas,
Q85: Suppose the common ancestor of cows and
Q86: A gene found in E. coli is
Q92: Most emerging diseases are caused by
A) viruses.
B)
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents