How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'
A) 7
B) 8
C) 10
D) 13

Question

Quizplus · Accepted Answer

Translation of the mRNA sequence begins at the start codon AUG and ends at a stop codon. The sequence provided starts with AUG (the start codon) and translates into amino acids until a stop codon is reached. The sequence AUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA translates into amino acids until the stop codon (UGA, UAA, or UAG) is encountered. Counting the codons from AUG until just before the stop codon gives 8 amino acids.

How Many Amino Acids Would Be Included in the Polypeptide