A diploid fungal cell is homozygous for a (TTG)5 trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.)
ATGTTGTTGTTGTTGTTGTGA
Correct Answer:
Answered by Quizplus AI
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q26: A polypeptide has the following amino acid
Q27: A single base substitution caused the amino
Q28: The following sequence represents the DNA template
Q29: How do mutation rates differ among eukaryotic
Q30: Tumor suppressor proteins can assist in slowing
Q32: Explain how an individual with a suppressor
Q33: Helen has type I osteogenesis imperfecta (OI),
Q34: List all single-base substitutions that would change
Q35: A polypeptide has the following amino acid
Q36: Why do insertions and deletions often have
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents