Solved

A Diploid Fungal Cell Is Homozygous for a (TTG)5 Trinucleotide

Question 31

Short Answer

A diploid fungal cell is homozygous for a (TTG)5 trinucleotide repeat at a particular locus (see sequence below). During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other. How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.)
ATGTTGTTGTTGTTGTTGTGA

Correct Answer:

Answered by Quizplus AI

Answered by Quizplus AI

To solve this problem, we need to unders...

View Answer

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents