This DNA sequence represents an open reading frame (ORF)of a transcriptional unit.Transcribe and then translate this gene in the spaces provided below.
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q2: The genetic code uses three bases to
Q46: On polyribosomes, the direction of mRNA transcription
Q47: What would be the effect on the
Q49: A yeast strain was exposed to a
Q51: Compute how many (different)nucleotide sequences can encode
Q52: List the codon, anticodon, and DNA code
Q53: Which of the following codons is often
Q54: List three differences between prokaryotic and eukaryotic
Q56: Describe the events in prokaryotic translation initiation.
Q63: Although the genetic code is nearly universal,
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents