Question 1

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-If we assume that a gap is equivalent to two nucleotide substitutions, how many substitutions have occurred between D. melanogaster and D. erecta?

Accepted Answer

The answer of Use the following to answer questions :
Suppose...

Question 2

Genes found in different species whose divergence occurred as a consequence of speciation are known as _______.

Accepted Answer

The answer of Genes found in different species whose divergence...

Question 3

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How many substitutions have occurred between D. melanogaster and D. simulans?

Accepted Answer

The answer of Use the following to answer questions :
Suppose...

Question 4

In their studies of evolution within Pseudomonas, Rainsey and Travisano observed a new form called _______ that was able to form a mat across the medium's surface and thus compete more successfully for oxygen.

Accepted Answer

The answer of In their studies of evolution within Pseudomonas,...

Question 5

Suppose the common ancestor of cows and whales had an A at one nucleotide site. At this site, whales have G and cows have T. This would be an example of _______ substitution.

Accepted Answer

The answer of Suppose the common ancestor of cows and...

Question 6

A gene found in E. coli is not found in closely related species of bacteria, but similar genes are found in distantly related bacteria. The most likely explanation for this observation is _______.

Accepted Answer

The answer of A gene found in E. coli is...

Question 7

To determine the rates at which organisms lose DNA, researchers have used _______ that have LTRs.

Accepted Answer

The answer of To determine the rates at which organisms...

Question 8

Biologists who are searching for a natural compound to improve corn yield are practicing _______.

Accepted Answer

The answer of Biologists who are searching for a natural...

Question 9

The developmental genes bicoid and zen are derived from a relatively old gene duplication. They are thus _______.

Accepted Answer

The answer of The developmental genes bicoid and zen are...

Question 10

A sequence of DNA that arose from a gene duplication and is no longer functional is known as a _______.

Accepted Answer

The answer of A sequence of DNA that arose from...

Question 11

Use the following to answer questions :
Sequences of a hypothetical gene that codes for an enzyme were obtained from several species of rodents. Refer to the diagram below, showing the rate of nonsynonymous and synonymous substitutions for each of four regions of the gene. 
-Which region is under the strongest stabilizing ­selection?

Accepted Answer

The answer of Use the following to answer questions :
Sequences...

Question 12

Suppose the ancestral nucleotide at position 786 is A, and the same substitution from A to G occurs in both descendant lineages. This substitution would be called a _______ substitution.

Accepted Answer

The answer of Suppose the ancestral nucleotide at position 786...

Question 13

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How would you align the three sequences so that they could be used for making comparisons?

Accepted Answer

The answer of Use the following to answer questions :
Suppose...

Question 14

The enzyme _______ has evolved new functions in animals that perform foregut _______.

Accepted Answer

The answer of The enzyme _______ has evolved new functions...

Question 15

Many more synonymous than nonsynonymous substitutions have occurred in insects in the gene sevenless, a gene that is involved in eye development. This gene is most likely under _______ selection.

Accepted Answer

The answer of Many more synonymous than nonsynonymous substitutions have...

Question 16

Chorion genes are involved in making the eggshells of many species of insects. In some species, the multiple copies of these chorion genes evolved so as to maintain similarity of the copies within the same species. This phenomenon is known as _______ evolution.

Accepted Answer

The answer of Chorion genes are involved in making the...

Question 17

Two species of pine trees differ by a nucleotide substitution in the coding region of a gene, but the proteins produced by this gene are the same in both species. This substitution is thus a _______ substitution.

Accepted Answer

The answer of Two species of pine trees differ by...

Question 18

A group of homologous genes with related functions is known as a _______.

Accepted Answer

The answer of A group of homologous genes with related...

Question 19

Kimura's _______ theory of molecular evolution proposes that most molecular variations in natural populations are selectively equivalent.

Accepted Answer

The answer of Kimura's _______ theory of molecular evolution proposes...

Question 20

Two species of grasshopper have the same neutral mutation rate for any particular gene, but species A has a population size that is ten times the size of species B. The substitution rate in species A should be about _______ as that of species B.

Accepted Answer

The answer of Two species of grasshopper have the same...

Quiz 24: Evolution of Genes and Genomes

Genes found in different species whose divergence occurred as a consequence of speciation are known as _______.

In their studies of evolution within Pseudomonas, Rainsey and Travisano observed a new form called _______ that was able to form a mat across the medium's surface and thus compete more successfully for oxygen.

Suppose the common ancestor of cows and whales had an A at one nucleotide site. At this site, whales have G and cows have T. This would be an example of _______ substitution.

A gene found in E. coli is not found in closely related species of bacteria, but similar genes are found in distantly related bacteria. The most likely explanation for this observation is _______.

To determine the rates at which organisms lose DNA, researchers have used _______ that have LTRs.

Biologists who are searching for a natural compound to improve corn yield are practicing _______.

The developmental genes bicoid and zen are derived from a relatively old gene duplication. They are thus _______.

A sequence of DNA that arose from a gene duplication and is no longer functional is known as a _______.

Suppose the ancestral nucleotide at position 786 is A, and the same substitution from A to G occurs in both descendant lineages. This substitution would be called a _______ substitution.

The enzyme _ has evolved new functions in animals that perform foregut _.

Many more synonymous than nonsynonymous substitutions have occurred in insects in the gene sevenless, a gene that is involved in eye development. This gene is most likely under _______ selection.

Chorion genes are involved in making the eggshells of many species of insects. In some species, the multiple copies of these chorion genes evolved so as to maintain similarity of the copies within the same species. This phenomenon is known as _______ evolution.

Two species of pine trees differ by a nucleotide substitution in the coding region of a gene, but the proteins produced by this gene are the same in both species. This substitution is thus a _______ substitution.

A group of homologous genes with related functions is known as a _______.

Kimura's _______ theory of molecular evolution proposes that most molecular variations in natural populations are selectively equivalent.

Two species of grasshopper have the same neutral mutation rate for any particular gene, but species A has a population size that is ten times the size of species B. The substitution rate in species A should be about _______ as that of species B.