Question 1

Which statement about the Human Genome Project (HGP)is false?
A) The sequencing of smaller genomes helped in the development of methods that benefited the HGP.
B) Only privately funded groups were involved in the sequencing effort.
C) The HGP was in part spurred on by a desire to determine the specific DNA damage caused by radiation from the atomic blasts on Japan during World War II.
D) One objective of the HGP was to identify genetic changes associated with disease.
E) It was completed in the first decade of the twenty-first century.

Accepted Answer

This statement is false as publicly funded institutions such as the National Institutes of Health were also involved in the sequencing effort of the Human Genome Project, in addition to privately funded groups.

Question 2

DNA sequencing resembles the natural process of
A) protein synthesis.
B) DNA repair.
C) DNA replication.
D) reverse transcription.
E) alternative splicing.

Accepted Answer

DNA sequencing involves reading the order of nucleotides in a DNA molecule. This process is similar to DNA replication, where a cell copies its DNA before cell division. During DNA replication, the DNA molecule is unzipped and each strand acts as a template for the creation of a new complementary strand. Similarly, during DNA sequencing, the DNA molecule is read and the order of nucleotides is determined.

Question 3

What is the major difference between the DNA sequencing techniques developed by Sanger and others in the 1970s and high-throughput sequencing methods?
A) High-throughput sequencing enables the direct sequencing of a chromosome from one end to the next.
B) Unlike the earlier technology,high-throughput sequencing involves cutting the DNA into fragments.
C) Unlike the earlier technology,high-throughput sequencing relies heavily on miniaturization techniques.
D) High-throughput sequencing involves chemical modification of nucleotides,whereas the earlier technology does not.
E) Unlike the earlier technology,high-throughput sequencing does not use PCR.

Accepted Answer

High-throughput sequencing relies heavily on miniaturization and parallelization techniques, allowing for the simultaneous sequencing of millions of DNA fragments, which is a major advancement over the Sanger method.

Question 4

Which statement about dogs and dog genomes is false?
A) Dogs vary tremendously in size and shape because they were domesticated from many different,and different looking,species of wolves.
B) Most of the genes of dogs have close counterparts to genes in humans.
C) Many of the diseases of dogs have close counterparts to diseases in humans.
D) Genetic markers can be used to determine the location of genes that influence traits in dogs.
E) The molecular methods used to analyze dogs have been applied to many other animals.

Accepted Answer

Dogs were domesticated from a single species of wolf, not from many different species.

Question 5

In high-throughput DNA sequencing technology,the PCR technique
A) breaks the DNA into small fragments.
B) produces many identical copies of specific DNA fragments.
C) labels each of the four nucleotides with a different marker.
D) enables overlapping sequences to be assembled into one complete sequence.
E) chemically modifies each nucleotide.

Accepted Answer

PCR (polymerase chain reaction) is a technique used in high-throughput DNA sequencing to amplify specific regions of DNA. It produces many identical copies of the targeted DNA sequence, allowing for easier detection and sequencing.

Question 6

In high-throughput DNA sequencing,the universal adapter sequence is _______ to the universal _______ sequence.
A) identical;primer
B) identical;polymerase
C) identical;template
D) complementary;primer
E) complementary;polymerase

Accepted Answer

In high-throughput DNA sequencing, the sequencing process involves adding adapters to the DNA fragments. The adapters are typically short, double-stranded DNA molecules with a known sequence that can be used for amplification and sequencing. The universal adapter is designed to be complementary to a primer sequence that is used during the sequencing process. Therefore, the universal adapter sequence is complementary to the universal primer sequence.

Question 7

A biologist who is trying to find open reading frames in a section of DNA is working in the field of
A) functional genomics.
B) comparative genomics.
C) metagenomics.
D) biodiversity.
E) proteomics.

Accepted Answer

The identification of open reading frames (ORFs) in DNA is a key step in functional genomics, which aims to understand how genes function and interact to produce biological traits and disease states. Comparative genomics compares genome sequences across different species or groups to identify similarities and differences in gene structure, function, and evolution. Metagenomics studies the genomes of microbial communities found in environmental samples, such as soil or water. Biodiversity is the study of the variation of life forms within a given ecosystem, while proteomics is the study of the structure and function of proteins. While each of these fields may involve the analysis of DNA, the specific task of finding open reading frames is most closely associated with functional genomics.

Question 8

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3'): CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3'): CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?
A) CGACGTCGTCGCCCGATACGTTATCG
B) GTCGTCGCCCGATACGTTATCGCGAC
C) CGATACGTTATCGCGACGTCGTCGCC
D) CGATACGTCGTCGCCGTTATCGCGAC
E) CGAUACGUCGUCGCCGUUAUCGCGAC

Accepted Answer

To solve this problem, we need to look for fragments that appear in both methods of cutting DNA. In the first method, we have three fragments: CGATAC, GTCGTCGCC, and GTTATCGCGAC. In the second method, we have two fragments: CGACGTCGTCGCC and CGATACGTTATCG. We notice that CGATAC appears in both methods, and this means that it is part of the original sequence. We also notice that GTCGTCGCC appears only in the first method, and CGACGTCGTCGCC appears only in the second method. This means that these two fragments must be adjacent in the original sequence but are cut differently in the two methods. Therefore, the original sequence must be CGATACGTTATCGCGACGTCGTCGCC, which is choice C.

Question 9

A DNA sequence has been cut into the three overlapping sequence fragments below: (1)CCGCGCGTAGCGAGTCAG
(2)GGCTAGTTAGCTCCGCGCG
(3)AGTCAGTCAAAAT
What is the correct assembled sequence of these fragments?
A) GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT
B) CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT
C) CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG
D) AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC
E) AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA

Accepted Answer

The correct sequence is assembled by overlapping the fragments: (2) overlaps with (1) at "CCGCGCG", and (1) overlaps with (3) at "AGTCAG".

Question 10

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?
A) GTCATTGCTTGCAATGTT
B) TTGTAACGTTCGTTACTG
C) CAGTAACGAACGTTACAA
D) CCTGAATTGGTCGTACAA
E) GUCAUUGCUUGCAAUGUU

Accepted Answer

To perform DNA sequencing using the Sanger method, we need a primer that anneals to the template DNA and initiates DNA synthesis. The universal adapter sequence given above does not have a complementary sequence that can be used as a primer. However, we can design a universal primer that has a complementary sequence to the adapter sequence. This primer should start from a known region, such as the vector or the plasmid sequence, and extend into the inserted DNA fragment. 
Based on the given adapter sequence, the complementary sequence is 5'-AACGTTACAGTAA-3', and a suitable primer would be 5'-CAGTAACGAACGTTACAA-3' (Choice C). This primer has a Tm value of around 58-60°C and is long enough to provide good specificity and coverage of the DNA fragment during sequencing. The other choices are either too short, too dissimilar to the adapter sequence, or not complementary to the DNA fragment of interest.

Question 11

Which DNA sequence would be the most difficult to assemble?
A) A sequence with an ORF
B) A sequence consisting of several short repeated fragments
C) A sequence with roughly equal proportions of As,Cs,Gs,and Ts
D) A sequence with a promoter
E) A sequence that contains the fragment CAGCTATT

Accepted Answer

A sequence consisting of several short repeated fragments would be the most difficult to assemble because the repeated fragments can cause confusion and errors in the assembly process. It may not be clear which fragment belongs where, leading to difficulties in determining the correct order of the fragments.

Question 12

Which statement would be considered an expression of genetic determinism?
A) The proteome is more complex than the genome.
B) All people who are homozygous for the sickle-cell allele have sickle-cell disease.
C) Studying genes provides a limited understanding of what is going on in the cell.
D) The metabolome exerts considerable influence on the likelihood that an individual will develop diabetes.
E) High levels of glucose may be an indicator of coronary heart disease.

Accepted Answer

The statement in option B implies that genetics completely determine whether or not someone has sickle-cell disease, without considering any other factors such as environment or lifestyle. This is an expression of genetic determinism, which holds that genes are the sole determinants of one's biological traits and outcomes.

Question 13

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of
A) comparative genomics.
B) functional genomics.
C) pharmacogenomics.
D) metabolomics.
E) proteomics.

Accepted Answer

The study comparing proteins produced in sperm cells to those of skin cells is an example of proteomics, which is the study of the entire set of proteins produced by a cell or organism. Proteomics aims to identify and characterize all the proteins produced by a cell or organism, and compare their functions, interactions, and modifications. In this case, the study is comparing the proteome of two different types of cells - sperm cells and skin cells - to understand their unique features and roles in the body. The other choices are not applicable to this specific study: comparative genomics compares the genomes of different species or individuals to identify similarities and differences; functional genomics investigates the functions of genes, their expression, and regulation; pharmacogenomics studies the effects of drugs on gene expression and metabolism; and metabolomics analyzes the small molecules produced by cells or organisms, such as sugars, amino acids, and lipids.

Question 14

A biologist is using computer programs and mathematical tools to assemble a large sequence of DNA from the data provided by multiple parallel runs of high-throughput sequencing.The term that best describes this biologist's field of study is
A) functional genomics.
B) comparative genomics.
C) metagenomics.
D) biodiversity.
E) bioinformatics.

Accepted Answer

The use of computer programs and mathematical tools to analyze and interpret biological data, including DNA sequencing data, is known as bioinformatics. Therefore, the biologist in question is likely working in the field of bioinformatics. The other answer choices (A: functional genomics, B: comparative genomics, C: metagenomics, and D: biodiversity) may also involve the use of DNA sequencing data, but they do not specifically refer to the use of computational tools and software in analyzing the data.

Question 15

A promoter is an example of a(n)
A) open reading frame.
B) transposable element.
C) chromatin sequence.
D) rRNA gene.
E) regulatory sequence.

Accepted Answer

A promoter is a specific type of regulatory sequence that is located upstream of a gene and responsible for initiating transcription. Promoters can bind transcription factors and RNA polymerase, which initiates the transcription process. Thus, a promoter is an example of a regulatory sequence.

Question 16

A sequence contains an open reading frame that begins with a start codon.Most likely,it
A) contains highly repetitive DNA.
B) contains moderately repetitive DNA.
C) codes for a protein.
D) is in a centromeric region.
E) is in a teleomeric region.

Accepted Answer

The presence of a start codon indicates that the sequence is coding for a protein. Therefore, option C is the best choice. Options A, B, D, and E are incorrect because they do not necessarily indicate the presence of a start codon or coding potential.

Question 17

In high-throughput DNA sequencing technology,the fluorescent dye
A) breaks the DNA into fragments.
B) produces many identical copies of specific DNA fragments.
C) labels each of the four nucleotides with a different marker.
D) enables overlapping sequences to be assembled into one complete sequence.
E) chemically modifies each nucleotide.

Accepted Answer

The fluorescent dye used in high-throughput DNA sequencing technology is used to label each of the four nucleotides with a different color marker, which is important for detecting their incorporation during the sequencing process.

Question 18

A biologist sequencing the DNA of various species of pathogenic bacteria with the goal of determining their evolutionary relationships is practicing _______ genomics.
A) functional
B) operational
C) meta-
D) comparative
E) eukaryotic

Accepted Answer

Comparative genomics involves comparing the genomes of different species to better understand their evolutionary relationships. In this case, the biologist is comparing the genomes of different species of bacteria to determine their evolutionary relationships, making it an example of comparative genomics.

Question 19

Which statement about the human proteome is false?
A) It is the sum total of all proteins produced by an organism.
B) It is more complex than the genome.
C) It includes the small molecules found in a cell.
D) Its study often involves the use of two-dimensional gel electrophoresis.
E) All of the above are true;none is false.

Accepted Answer

The human proteome only includes the proteins produced by an organism and does not include small molecules found in a cell.

Question 20

A DNA sequence has been cut into the four overlapping sequence fragments below: (1)AGGGGCCTATAGCATACGTACA
(2)CGTACATCTGAGGGTACGATCATGGC
(3)CATGGCTAGCAAACGCGATCCCAAG
(4)AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?
A) 1;2;3;4
B) 1;3;2;4
C) 2;3;1;4
D) 4;1;2;3
E) 4;1;3;2

Accepted Answer

The answer of A DNA sequence has been cut into...

Quiz 12: Genomes

Which statement about the Human Genome Project (HGP) is false?

DNA sequencing resembles the natural process of

What is the major difference between the DNA sequencing techniques developed by Sanger and others in the 1970s and high-throughput sequencing methods?

Which statement about dogs and dog genomes is false?

In high-throughput DNA sequencing technology,the PCR technique

In high-throughput DNA sequencing,the universal adapter sequence is _ to the universal _ sequence.

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3') : CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3') : CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

A DNA sequence has been cut into the three overlapping sequence fragments below: (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments?

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?

Which DNA sequence would be the most difficult to assemble?

Which statement would be considered an expression of genetic determinism?

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of

A biologist is using computer programs and mathematical tools to assemble a large sequence of DNA from the data provided by multiple parallel runs of high-throughput sequencing.The term that best describes this biologist's field of study is

A promoter is an example of a(n)

A sequence contains an open reading frame that begins with a start codon.Most likely,it

In high-throughput DNA sequencing technology,the fluorescent dye

A biologist sequencing the DNA of various species of pathogenic bacteria with the goal of determining their evolutionary relationships is practicing _______ genomics.

Which statement about the human proteome is false?

A DNA sequence has been cut into the four overlapping sequence fragments below: (1) AGGGGCCTATAGCATACGTACA (2) CGTACATCTGAGGGTACGATCATGGC (3) CATGGCTAGCAAACGCGATCCCAAG (4) AGGCTAGTTACGATATAGGGGCC What is the correct order of these fragments?