Solved

In Frogs, Green Skin Is Determined by Gene B

Question 27

Multiple Choice

In frogs, green skin is determined by gene B.The wild-type sequence of the 5′ end of the RNA-like strand of the entire first exon is shown below.The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5′ ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3′
The table of codons is provided here: In frogs, green skin is determined by gene B.The wild-type sequence of the 5′ end of the RNA-like strand of the entire first exon is shown below.The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin. 5′ ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3′ The table of codons is provided here:   -Which are the first three amino acids encoded by the wild-type sequence of gene B? A) N-Thr-Gln-Ala… B) N-Pro-Asn-Asn… C) N-Met-Phe-Leu… D) N-Ser-Ser-Val… E) The correct sequence is not shown here.
-Which are the first three amino acids encoded by the wild-type sequence of gene B?


A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents