The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′ A)Allele b² has a frameshift mutation-a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B)Allele b² has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C)Allele b² has a missense mutation-a nucleotide substitution that changes one amino acid to another. D)Allele b² has a nonsense mutation-a nucleotide substitution that forms a stop codon. E)Allele b² has a silent mutation-a nucleotide substitution that does not change the protein.

Question

Quizplus · Accepted Answer

The mutation in allele b² results in a nucleotide substitution that creates a stop codon, leading to a premature termination of the protein synthesis, which is characteristic of a nonsense mutation.

The Sequence of Gene B from Another Baby Frog Who