HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
A) 0 times
B) 1 time
C) 2 times
D) 3 times
Correct Answer:
Verified
Q6: A vaccine works by _.
A)inhibiting bacterial reproduction
B)stimulating
Q7: Transgenic animals are currently produced for many
Q8: Which is the last step in the
Q9: What is the definition of a genetically
Q10: "Sticky ends" are _.
A)single-stranded ends of fragments
Q12: What is the best definition for recombinant
Q13: Which enzyme is used to bind DNA
Q14: When plasmids are used to produce a
Q15: The world's first genetically engineered pharmaceutical product
Q16: "Sticky ends" are _ that are produced
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents