Question 1

What evidence led to the confirmation that Albert DeSalvo was the Boston Strangler?
A)an analysis of blood types from the crime scene
B)an analysis of fingerprints from the crime scene
C)an analysis of DNA from the crime scene
D)an analysis of witness testimony from the crime scene

Accepted Answer

DNA analysis from the crime scene matched Albert DeSalvo's DNA, confirming him as the Boston Strangler.

Question 2

You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association?
A)You can use the sample to determine the individual's blood type.
B)You can use gel electrophoresis to determine the length of the DNA found in the sample.
C)You can use PCR to increase the amount of DNA available for STR analysis.

Accepted Answer

PCR (Polymerase Chain Reaction) can amplify the DNA in the blood sample, allowing for STR (Short Tandem Repeat) analysis, which can be used to match the DNA to a specific individual.

Question 3

Of these steps, which one occurs earliest in the process of producing recombinant DNA?
A)Human DNA fragments are mixed with the cut plasmids.
B)Restriction enzymes are used to isolate the gene of interest and to cut the plasmid DNA.
C)Recombinant plasmids are mixed with bacteria.
D)Bacteria carrying recombinant plasmids are cloned.

Accepted Answer

Restriction enzymes are used to isolate the gene of interest and to cut the plasmid DNA, which is the initial step in creating recombinant DNA.

Question 4

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.
A)gene cloning
B)PCR
C)STR analysis
D)whole-genome shotgun method

Accepted Answer

Gene cloning involves inserting a gene into a host organism's genome and then culturing the host to produce multiple copies of the gene.

Question 5

What is the definition of a "transgenic organism?"
A)an organism that is the first of its kind to show a particular phenotype
B)an organism in which a genetic defect has been corrected using gene therapy
C)an organism containing a gene from another species

Accepted Answer

A transgenic organism contains a gene or genes that have been artificially inserted from another species.

Question 6

A vaccine works by ________.
A)inhibiting bacterial reproduction
B)stimulating the immune system to develop lasting defenses
C)killing cells infected with a virus
D)preventing translation of mRNA molecules that code for disease-causing proteins

Accepted Answer

A vaccine stimulates the immune system to recognize and fight pathogens, providing immunity by developing lasting defenses.

Question 7

Transgenic animals are currently produced for many different reasons. Choose an example of a transgenic animal that currently does not exist.
A)pigs that carry a roundworm gene to produce omega-3 fatty acids
B)dairy cows that carry an Angus cattle gene so that they do not grow horns
C)Atlantic salmon that have been modified to grow twice as fast as normal
D)chickens that have been modified to be able to lay eggs in very hot temperatures

Accepted Answer

Currently, there are no transgenic chickens specifically modified to lay eggs in very hot temperatures.

Question 8

Which is the last step in the production of a recombinant DNA plasmid?
A)cloning
B)using DNA ligase to join DNA fragments
C)cutting the gene of interest into fragments
D)allowing the reproduction of the bacterium bearing the recombinant plasmid

Accepted Answer

The answer of Which is the last step in the...

Question 9

What is the definition of a genetically modified organism?
A)an organism carrying a gene that was acquired by artificial means
B)an organism in which a particular mutation has appeared for the first time
C)a cloned organism carrying two different alleles

Accepted Answer

A genetically modified organism (GMO) is one that has had its genetic material altered using genetic engineering techniques, often by introducing a gene from another species.

Question 10

"Sticky ends" are ________.
A)single-stranded ends of fragments of double-stranded DNA
B)regions of double-stranded DNA that can be cut by a restriction enzyme
C)portions of DNA used as markers for STR analysis

Accepted Answer

Sticky ends are single-stranded overhangs created when DNA is cut by certain restriction enzymes, allowing for the easy ligation of complementary DNA fragments.

Question 11

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
A)0 times
B)1 time
C)2 times
D)3 times

Accepted Answer

HindIII recognizes and cuts the sequence AAGCTT. In the given DNA molecule, this sequence appears twice: GTAAGCTTCGACAAGCTTGCTGA. Therefore, HindIII would cut the DNA molecule 2 times.

Question 12

What is the best definition for recombinant DNA?
A)a type of nucleic acid that includes both RNA and DNA strands
B)DNA that includes nucleotides from two different sources
C)an alternate form of DNA that is the product of a mutation

Accepted Answer

DNA that includes nucleotides from two different sources

Question 13

Which enzyme is used to bind DNA fragments together?
A)restriction enzyme
B)lysozyme
C)DNA ligase
D)DNA polymerase

Accepted Answer

DNA ligase is used to bind DNA fragments together by catalyzing the formation of phosphodiester bonds between the 3'-hydroxyl group of one DNA fragment and the 5'-phosphate group of another DNA fragment.

Question 14

When plasmids are used to produce a desired protein, the ________.
A)plasmids multiply and produce the protein outside of the bacterium
B)bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate
C)desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium
D)bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene

Accepted Answer

The desired gene is inserted into the plasmid, which is then introduced into a bacterium. The bacterium uses the plasmid to produce the desired protein.

Question 15

The world's first genetically engineered pharmaceutical product was ________.
A)humulin
B)human growth hormone
C)a vaccine against hepatitis B
D)erythropoietin

Accepted Answer

Humulin, a form of insulin, was the world's first genetically engineered pharmaceutical product, approved in 1982.

Question 16

"Sticky ends" are ________ that are produced by the action of ________.
A)double-stranded DNA molecules with double-stranded ends; DNA ligase
B)double-stranded DNA molecules with single-stranded ends; DNA ligase
C)double-stranded DNA molecules with double-stranded ends; restriction enzymes
D)double-stranded DNA molecules with single-stranded ends; restriction enzymes

Accepted Answer

Sticky ends are single-stranded overhangs on double-stranded DNA molecules produced by restriction enzymes cutting the DNA at specific sites.

Question 17

Of these steps, which occurs first in the production of a recombinant plasmid?
A)cloning
B)cutting DNA into fragments
C)isolation of a plasmid from a bacterium
D)reproduction of the engineered plasmid in bacteria

Accepted Answer

The first step in producing a recombinant plasmid is the isolation of a plasmid from a bacterium, which serves as the vector for inserting foreign DNA.

Question 18

A DNA fragment with the sticky end sequence TGGCA will bind with another DNA fragment with the sticky end sequence ________.
A)TGCCA
B)ACCGT
C)TGGCA
D)ACGGT

Accepted Answer

Sticky ends are complementary sequences. The sequence TGGCA will bind with its complementary sequence ACCGT.

Question 19

What can act as a vector to introduce new genes into a cell?
A)primers
B)ligase
C)restriction enzymes
D)plasmids

Accepted Answer

Plasmids are circular DNA molecules that can replicate independently and are commonly used as vectors to introduce new genes into cells.

Question 20

Restriction enzymes are obtained from ________.
A)archaea
B)eukaryotes
C)viruses
D)bacteria

Accepted Answer

Restriction enzymes are naturally occurring enzymes found in bacteria, where they serve as a defense mechanism against viral DNA by cutting it at specific sequences.

Quiz 12: Dna Technology

What evidence led to the confirmation that Albert DeSalvo was the Boston Strangler?

You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association?

Of these steps, which one occurs earliest in the process of producing recombinant DNA?

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

What is the definition of a "transgenic organism?"

A vaccine works by ________.

Transgenic animals are currently produced for many different reasons. Choose an example of a transgenic animal that currently does not exist.

Which is the last step in the production of a recombinant DNA plasmid?

What is the definition of a genetically modified organism?

"Sticky ends" are ________.

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

What is the best definition for recombinant DNA?

Which enzyme is used to bind DNA fragments together?

When plasmids are used to produce a desired protein, the ________.

The world's first genetically engineered pharmaceutical product was ________.

"Sticky ends" are that are produced by the action of .

Of these steps, which occurs first in the production of a recombinant plasmid?

A DNA fragment with the sticky end sequence TGGCA will bind with another DNA fragment with the sticky end sequence ________.

What can act as a vector to introduce new genes into a cell?

Restriction enzymes are obtained from ________.