Short regions of chromosome 1 were sequenced in a population of Drosophila. These sequences from three different flies are shown below. Identify the SNP haplotype for Fly #3. Fly #1: 5ʹ ATGGCACGAAGCTAAGAATA 3ʹ
Fly #2: 5ʹ ATGGCTCGACGCTCATAATA 3ʹ
Fly #3: 5ʹ ATGGCGCGATGCTAAGAATC 3ʹ
A) 5ʹ GTAGC 3ʹ
B) 5ʹ CGATG 3ʹ
C) 5ʹ GTAGA 3ʹ
D) 5ʹ NNAGA 3ʹ
E) 5ʹ CATCG 3ʹ
Correct Answer:
Verified
Q3: You've cloned a 2-kb fragment of
Q4: For a physical map of a chromosome,
Q5: Which of the following is NOT a
Q6: What is metagenomics and what important issues
Q7: A section of a genome is cut
Q9: A linear DNA fragment is cut with
Q10: Crossing over is often reduced around centromeric
Q11: Linkage disequilibrium is the nonrandom association among
Q12: If a restriction enzyme cuts a circular
Q13: Which of the following is a disadvantage
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents