Solved

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC

Question 21

Multiple Choice

GGGCCATTCGAACGTCCGAAAATGCCCCTGAATGAAAATTTTGGCCC. The primer used for replication in vitro is CCCGGTAAGCTT. Where is the 5' end for the template and primer, respectively?


A) Left, left
B) Right, left
C) Left, right
D) Right, right

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Unlock this Answer For Free Now!

View this answer and more for free by performing one of the following actions

qr-code

Scan the QR code to install the App and get 2 free unlocks

upload documents

Unlock quizzes for free by uploading documents