Question 1

A small amount of DNA is collected from a crime scene.However,the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime.Which method could be utilized to increase the amount of DNA?

Accepted Answer

Polymerase chain reaction (PCR) is the best choice as it can amplify a small amount of DNA into billions of copies. This will increase the amount of DNA available for further experiments and analysis. Microarray analysis, gel electrophoresis, fluorescent labeling of DNA, and DNA sequencing are not designed to amplify small quantities of DNA.

Question 2

You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer.You have several genes you think may be involved,so you "print" spots of the DNA sequences of interest on a microarray slide.After doing this,you isolate mRNA from both normal lung cells and cancerous lung cells.Before you use these mRNAs to probe the microarray slide,what do you need to do?

Accepted Answer

To probe the microarray slide, mRNA must first be converted to cDNA using reverse transcriptase and fluorescent nucleotides. This will allow for the detection and measurement of gene expression levels in the normal and cancerous lung cells. There is no need to amplify the mRNA using PCR since this can introduce bias, and sequencing or cloning each mRNA into a BAC vector would be too time-consuming and costly.

Question 3

You analyze some DNA using an automated sequence reaction.The first peak you observe is labeled with a red fluorescent label.From this you can conclude that the most ____ base in the DNA is a _____ containing the red fluorescent label.

Accepted Answer

In automated DNA sequencing, dideoxynucleotides are used to terminate DNA synthesis. The color of the fluorescent label indicates which base is incorporated. Since DNA synthesis occurs in the 5' to 3' direction, the first base observed (with the red label) would be at the 3' end of the synthesized strand, making it a 3', dideoxynucleotide.

Question 4

You cut a plasmid with a restriction enzyme that cuts it into three pieces - one fragment is 240 base pairs,one fragment is 600 base pairs,and one fragment is 1200 base pairs.You carry out electrophoresis of the digested sample.After ten minutes,which of the fragments,if any,will be closest to the top of the gel where the samples were inserted?

Accepted Answer

In gel electrophoresis, smaller DNA fragments move faster and farther through the gel than larger fragments. Therefore, the 1200 base pair fragment, being the largest, will be closest to the top where the samples were inserted, as it will move the slowest.

Question 5

Shown below is the output from an automated sequencing reaction.What is the sequence of the DNA template strand?

Accepted Answer

3' - GGACTATCTCAGAGGGA - 5'

Question 6

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use?
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

Accepted Answer

The answer of You have the following DNA template and...

Question 7

The FtsZ gene in bacteria encodes an ancestral tubulin that is important in binary fission (the mechanism of cell division in prokaryotes).To study the FtsZ gene in eukaryotes,researchers made an FtsZ knockout in the moss What statement about this knockout plant is accurate?

Accepted Answer

The statement that is accurate about the FtsZ knockout plant is that it does not produce any normal FtsZ protein. A knockout refers to the intentional inactivation of a gene, which in this case is the FtsZ gene. The knockout plant would lack the normal FtsZ protein that is encoded by the gene, and may or may not produce an abnormal form of the protein. Therefore, options A, C, D, and E are incorrect.

Question 8

_____ occurs when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO).

Accepted Answer

Gene replacement is the correct term for when a cloned gene recombines with the normal gene on a chromosome, resulting in a genetically modified organism (GMO). This process involves replacing an existing gene with a modified version to achieve desired traits or functions in the organism.

Question 9

In a DNA microarray,_____ are attached to the slide and ___ are fluorescently labeled.

Accepted Answer

In a DNA microarray, the samples (which can be cDNA or cRNA) are attached to the slide, and the cDNAs (which are complementary to the genes of interest) are fluorescently labeled to detect gene expression levels.

Question 10

A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots)into a mammal so that the protein will be secreted into the milk of the mammary gland.What is required for the researcher's success?

Accepted Answer

The gene should be placed next to the promoter of a gene that is expressed in mammary cells, to allow for expression of the tissue plasminogen activator gene specifically in mammary cells and secretion of the protein into the milk. Placing the gene far from a mammary-specific promoter (A) or replacing a mammary-specific promoter (C) would not lead to optimal expression in mammary cells. Placing the gene next to a promoter expressed in multiple cell types (D) or replacing a promoter expressed in multiple cell types (E) may lead to undesirable off-target effects in other tissues.

Question 11

Following treatment with restriction enzymes,what procedure would be used to separate DNA fragments of different lengths?

Accepted Answer

Gel electrophoresis is the technique used to separate DNA fragments of different lengths. This technique uses an electric field to separate the fragments based on size, allowing for visualization and analysis of the DNA.

Question 12

Why is Taq polymerase used in a polymerase chain reaction (PCR)?

Accepted Answer

Taq polymerase is heat stable and can survive the high temperatures used in the denaturation step of PCR. This makes it an ideal choice for PCR as it ensures that the enzyme remains active throughout the process.

Question 13

Primers are used in both PCR and in DNA sequencing.What is the purpose of the primers?

Accepted Answer

The purpose of primers is to provide a 3'- OH for DNA polymerase to begin building a new DNA strand. This is necessary because DNA polymerase can only add nucleotides to an existing 3'- OH group. Therefore, primers anneal to the template DNA strand and provide the necessary starting point for polymerization.

Question 14

The protein p53 is a tumor suppressor - it regulates the cell cycle and is important in preventing cancer in humans.What phenotype would you expect in p53 knockout mice?

Accepted Answer

p53 is a tumor suppressor and important in preventing cancer in humans. Therefore, knockout of this protein would lead to an increased susceptibility to cancers, making option D the correct answer.

Question 15

You have the target DNA and primers shown below.You add the target DNA and primers,along with dATP,dTTP,dGTP,dCTP and Taq DNA polymerase to a test tube.After 30 cycles of PCR,which of the following is true about the DNA in your test tube?
Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
Primer 1: 5' - GATCAA - 3'
Primer 2: 5' - CGGAAA - 3'

Accepted Answer

After 30 cycles of PCR, there will be around a billion DNA molecules and most will contain the region that is flanked by the primers, which is 5' - GATCAATCAATGCCGAATTTCCG - 3' and 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. The primers will anneal to the target DNA and Taq DNA polymerase will replicate the region between the primers, resulting in most of the amplified DNA molecules containing this region.

Question 16

What field of science is a researcher practicing if she is conducting experiments which attempt to map the location of a gene on a particular chromosome?

Accepted Answer

Mapping the location of a gene on a particular chromosome falls under the field of genomics, which is the study of an organism's complete set of DNA or its genome. Reproductive genomics focuses on the study of genes related to reproduction, functional genomics studies gene function, and proteomics studies the entire set of proteins in an organism. Electrophoresis is a technique used for separating molecules based on their size and charge.

Question 17

What is an advantage of cDNA libraries over genomic libraries?

Accepted Answer

cDNA libraries only contain protein-coding exons, while genomic libraries include non-coding regions like introns. This makes cDNA libraries more efficient for studying expressed genes and identifying potential drug targets.

Question 18

Dideoxy nucleotides are used in which of the following processes?

Accepted Answer

Dideoxy nucleotides are commonly used in the Sanger method of DNA sequencing.

Question 19

What is an advantage of molecular pharming compared to expression of mammalian proteins in bacteria?

Accepted Answer

Molecular pharming involves the production of pharmaceuticals in genetically modified animals or plants, which can carry out the necessary post-translational modifications needed for the proper function of many mammalian proteins. Bacteria, on the other hand, often cannot perform these modifications, which can affect the functionality of the expressed protein.

Question 20

You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer.You have several genes you think may be involved,so you "print" spots of the candidate DNA sequences on a microarray slide.After doing this,you isolate mRNA from both normal lung cells and cancerous lung cells.You make fluorescently-tagged cDNA from each mRNA sample;the cDNAs from normal cells are tagged with a green-colored molecule and the cDNAs from cancer cells are tagged with a red-colored molecule.You hybridize the cDNAs with the microarray and get the following data.(Green spots are labeled with "G",red spots are labeled with "R"). 
What spots represent DNA that you should study further as potentially having a role in lung cancer?

Accepted Answer

The answer of You are working in a cancer lab...

Quiz 16: Genetic Technology

A small amount of DNA is collected from a crime scene.However,the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime.Which method could be utilized to increase the amount of DNA?

You analyze some DNA using an automated sequence reaction.The first peak you observe is labeled with a red fluorescent label.From this you can conclude that the most base in the DNA is a _ containing the red fluorescent label.

Shown below is the output from an automated sequencing reaction.What is the sequence of the DNA template strand?

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined.What primer should you use? 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

The FtsZ gene in bacteria encodes an ancestral tubulin that is important in binary fission (the mechanism of cell division in prokaryotes) .To study the FtsZ gene in eukaryotes,researchers made an FtsZ knockout in the moss What statement about this knockout plant is accurate?

_____ occurs when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO) .

In a DNA microarray,___ are attached to the slide and _ are fluorescently labeled.

A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland.What is required for the researcher's success?