The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed nucleotide change is equivalent to two nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.
Correct Answer:
Verified
Q93: A sequence of DNA that arose from
Q94: Two species of grasshoppers have the same
Q95: The developmental genes bicoid and zen are
Q96: A biologist is examining species of plants
Q97: Most mutations in studies using in vitro
Q99: A reversion is also known as a
Q100: The sickness whooping cough is caused by
Q101: Two species of plants that diverged 25
Q102: Puffer fish are resistant to poisoning by
Q103: Concerted evolution can occur through either unequal
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents