In the Eukaryotic DNA Sequence Below, Each Highlighted Sequence Consists

In the eukaryotic DNA sequence below, each highlighted sequence consists of a simple-sequence repeat. How are the underlined regions organized relative to one another? ATTATCATCATCATCATCATTTACTAATCCTCATCATCATCATCATGGAATCTACATCATCATCATCAT

A) as tandem repeats
B) as dispersed repeats
C) as inverted repeats
D) as long terminal repeats
E) as short terminal repeats