This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′
-If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?
A)Phe Asp His
B)Met Asn Gly Trp
C)Met Asn Gly
D)Translation will not begin.

Question

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′  
-If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?
A)Phe Asp His 
B)Met Asn Gly Trp 
C)Met Asn Gly 
D)Translation will not begin.

Quizplus · Accepted Answer

The Answer of This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′  
-If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?
A)Phe Asp His 
B)Met Asn Gly Trp 
C)Met Asn Gly 
D)Translation will not begin.

This Sequence Is the 5′ End of a MRNA: 5′