The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT.
5?…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3?

Question

Quizplus · Accepted Answer

The mRNA sequence starts from the transcription start site and is the same as the sequence of the coding strand of the DNA (and complementary to the "template strand") except that T is replaced with U.

The Sequence of a Region of DNA Around the 5