Hardy-Weinberg equilibrium is possible only if the population is
A) small, with no migration out of in, and females outnumbering males.
B) large, with random mating and no migration, mutation, genetic drift, or natural selection.
C) small, with nonrandom mating and no migration, mutation, genetic drift, or artificial selection.
D) large, with nonrandom mating, mutation, genetic drift, and natural selection.
E) comprised of very young and fertile individuals and no newcomers arrive.
Correct Answer:
Verified
Q13: Which choice describes a biological population?
A) a
Q14: In a population in Hardy-Weinberg equilibrium,75 percent
Q15: For a very rare inherited disease,the frequency
Q16: If one person in 50 is a
Q17: In a population in Hardy-Weinberg equilibrium,frequency of
Q19: Hardy-Weinberg calculations are based on
A) the binomial
Q20: If the incidence of Tay-Sachs is 1/3,600
Q21: An RFLP is a
A) DNA probe used
Q22: Which of the following have the longest
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A) VNTR.
B)
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents