An RFLP is a
A) DNA probe used for hybridization experiments.
B) variation in size of a DNA segment cut by a specific restriction enzyme.
C) recessive form of a deleterious allele.
D) restrictive enzyme used to cut DNA.
E) copy number variant used in forensic investigations.
Correct Answer:
Verified
Q16: If one person in 50 is a
Q17: In a population in Hardy-Weinberg equilibrium,frequency of
Q18: Hardy-Weinberg equilibrium is possible only if the
Q19: Hardy-Weinberg calculations are based on
A) the binomial
Q20: If the incidence of Tay-Sachs is 1/3,600
Q22: Which of the following have the longest
Q23: The DNA sequence GATCTGATCTGATCTGATCT is a(n)
A) VNTR.
B)
Q24: A series of markers have the following
Q25: DNA profiling was less useful in identifying
Q26: Mitochondrial DNA is helpful in obtaining a
Unlock this Answer For Free Now!
View this answer and more for free by performing one of the following actions
Scan the QR code to install the App and get 2 free unlocks
Unlock quizzes for free by uploading documents